Incidental Mutation 'R6343:Ncdn'
ID513988
Institutional Source Beutler Lab
Gene Symbol Ncdn
Ensembl Gene ENSMUSG00000028833
Gene Nameneurochondrin
Synonymsnorbin, neurochondrin-1, neurochondrin-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126743750-126753438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126747171 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 512 (D512G)
Ref Sequence ENSEMBL: ENSMUSP00000101722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030637] [ENSMUST00000106116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030637
AA Change: D512G

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030637
Gene: ENSMUSG00000028833
AA Change: D512G

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 3e-209 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106116
AA Change: D512G

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101722
Gene: ENSMUSG00000028833
AA Change: D512G

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 9.1e-217 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127079
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich cytoplasmic protein, which is highly similar to a mouse protein that negatively regulates Ca/calmodulin-dependent protein kinase II phosphorylation and may be essential for spatial learning processes. Several alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene results in early embryonic lethality in the homozygous state and impaired chondrocyte proliferation and differentiation in the heterozygous state. Gene trap mutation resulted in lacrimal gland hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Ncdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ncdn APN 4 126747188 missense probably benign 0.00
R0031:Ncdn UTSW 4 126750108 unclassified probably null
R0135:Ncdn UTSW 4 126746669 missense probably benign 0.37
R0413:Ncdn UTSW 4 126750534 missense possibly damaging 0.52
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1486:Ncdn UTSW 4 126748598 missense probably damaging 1.00
R1533:Ncdn UTSW 4 126748698 nonsense probably null
R1785:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1786:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1789:Ncdn UTSW 4 126752003 missense probably damaging 1.00
R1791:Ncdn UTSW 4 126751939 critical splice donor site probably null
R3406:Ncdn UTSW 4 126748595 missense probably benign 0.09
R4547:Ncdn UTSW 4 126746674 missense probably damaging 1.00
R4863:Ncdn UTSW 4 126750423 missense probably damaging 1.00
R4916:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4917:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4918:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R5218:Ncdn UTSW 4 126750810 missense probably benign 0.13
R5356:Ncdn UTSW 4 126747228 missense probably damaging 1.00
R5617:Ncdn UTSW 4 126745047 missense probably damaging 0.99
R5718:Ncdn UTSW 4 126749950 nonsense probably null
R6057:Ncdn UTSW 4 126745031 missense probably benign 0.05
R6986:Ncdn UTSW 4 126747229 missense probably damaging 1.00
R6988:Ncdn UTSW 4 126747189 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAACCTTCAAGTGGCACTGG -3'
(R):5'- TCTGTCTCCACATGTCAGGC -3'

Sequencing Primer
(F):5'- GTTCTGAAACCGGCTTATGCTAAC -3'
(R):5'- CCACATGTCAGGCTCCTC -3'
Posted On2018-04-27