Incidental Mutation 'R6343:Eya3'
ID513989
Institutional Source Beutler Lab
Gene Symbol Eya3
Ensembl Gene ENSMUSG00000028886
Gene NameEYA transcriptional coactivator and phosphatase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132638987-132724765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132672910 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 80 (I80T)
Ref Sequence ENSEMBL: ENSMUSP00000123045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020197] [ENSMUST00000079157] [ENSMUST00000081726] [ENSMUST00000135299] [ENSMUST00000180250]
Predicted Effect probably benign
Transcript: ENSMUST00000020197
SMART Domains Protein: ENSMUSP00000020197
Gene: ENSMUSG00000028886

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000079157
AA Change: I64T

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078157
Gene: ENSMUSG00000028886
AA Change: I64T

DomainStartEndE-ValueType
low complexity region 72 89 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
PDB:4EGC|B 226 510 1e-135 PDB
SCOP:d1lvha_ 345 507 8e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081726
AA Change: I80T

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080425
Gene: ENSMUSG00000028886
AA Change: I80T

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
Pfam:Hydrolase 256 502 5.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134868
Predicted Effect probably damaging
Transcript: ENSMUST00000135299
AA Change: I80T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123045
Gene: ENSMUSG00000028886
AA Change: I80T

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
low complexity region 227 239 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157029
Predicted Effect probably benign
Transcript: ENSMUST00000180250
SMART Domains Protein: ENSMUSP00000136812
Gene: ENSMUSG00000028886

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. It can act as a mediator of chemoresistance and cell survival in Ewing sarcoma cells, where this gene is up-regulated via a micro-RNA that binds to the 3' UTR of the transcript. A similar protein in mice acts as a transcriptional activator. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal heart function, decreased grip strength and increased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Eya3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Eya3 APN 4 132704398 missense probably damaging 1.00
IGL01104:Eya3 APN 4 132711929 missense probably damaging 1.00
IGL01109:Eya3 APN 4 132693000 nonsense probably null
IGL01145:Eya3 APN 4 132709995 missense probably damaging 1.00
IGL02364:Eya3 APN 4 132710055 missense probably damaging 1.00
IGL03008:Eya3 APN 4 132706983 missense probably damaging 1.00
IGL03144:Eya3 APN 4 132693142 missense probably benign 0.07
IGL03176:Eya3 APN 4 132711922 missense possibly damaging 0.90
R0279:Eya3 UTSW 4 132719247 missense probably damaging 1.00
R0621:Eya3 UTSW 4 132694802 missense probably benign 0.00
R0893:Eya3 UTSW 4 132689786 missense probably benign 0.01
R1416:Eya3 UTSW 4 132707129 splice site probably benign
R1834:Eya3 UTSW 4 132707118 missense probably damaging 0.99
R1903:Eya3 UTSW 4 132721352 unclassified probably null
R4696:Eya3 UTSW 4 132670232 nonsense probably null
R4739:Eya3 UTSW 4 132721387 utr 3 prime probably benign
R4758:Eya3 UTSW 4 132694885 critical splice donor site probably null
R5061:Eya3 UTSW 4 132704378 missense probably damaging 1.00
R5411:Eya3 UTSW 4 132689779 missense probably damaging 0.99
R5479:Eya3 UTSW 4 132672933 missense possibly damaging 0.91
R6117:Eya3 UTSW 4 132711862 missense probably damaging 1.00
R6443:Eya3 UTSW 4 132711927 missense probably damaging 1.00
R6460:Eya3 UTSW 4 132680863 missense probably damaging 0.97
R7116:Eya3 UTSW 4 132694799 missense probably benign 0.00
R7418:Eya3 UTSW 4 132680848 missense possibly damaging 0.92
R7594:Eya3 UTSW 4 132694825 missense probably benign
R7624:Eya3 UTSW 4 132672951 missense probably benign 0.41
R7811:Eya3 UTSW 4 132711961 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACCTGAAAAGGGCCAAACTTG -3'
(R):5'- GCGTAACTTCTACCAAACGC -3'

Sequencing Primer
(F):5'- CCAAACTTGGGTTTTCTGACC -3'
(R):5'- AGCCACGCTTGCTTTCTGAG -3'
Posted On2018-04-27