Incidental Mutation 'R6343:Pigv'
ID513990
Institutional Source Beutler Lab
Gene Symbol Pigv
Ensembl Gene ENSMUSG00000043257
Gene Namephosphatidylinositol glycan anchor biosynthesis, class V
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location133660387-133672647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133665236 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 208 (V208M)
Ref Sequence ENSEMBL: ENSMUSP00000050647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062118] [ENSMUST00000067902]
Predicted Effect probably damaging
Transcript: ENSMUST00000062118
AA Change: V208M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050647
Gene: ENSMUSG00000043257
AA Change: V208M

DomainStartEndE-ValueType
Pfam:Mannosyl_trans2 8 493 6.4e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067902
SMART Domains Protein: ENSMUSP00000065601
Gene: ENSMUSG00000043257

DomainStartEndE-ValueType
Pfam:Mannosyl_trans2 10 119 2.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151837
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannosyltransferase enzyme involved in the biosynthesis of glycosylphosphatidylinositol (GPI). GPI is a complex glycolipid that functions as a membrane anchor for many proteins and plays a role in multiple cellular processes including protein sorting and signal transduction. The encoded protein is localized to the endoplasmic reticulum and transfers the second mannose to the GPI backbone. Mutations in this gene are associated with hyperphosphatasia mental retardation syndrome. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy, are runted, have thymus hypoplasia and show craniofacial and kidney defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Pigv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Pigv APN 4 133665117 missense probably benign 0.01
IGL03157:Pigv APN 4 133665530 missense probably benign 0.01
R0256:Pigv UTSW 4 133665751 missense probably damaging 1.00
R0925:Pigv UTSW 4 133662649 missense probably benign 0.05
R1733:Pigv UTSW 4 133664926 missense probably damaging 1.00
R2014:Pigv UTSW 4 133662723 missense possibly damaging 0.55
R3794:Pigv UTSW 4 133665191 missense possibly damaging 0.94
R3795:Pigv UTSW 4 133665191 missense possibly damaging 0.94
R4349:Pigv UTSW 4 133664816 missense probably benign
R5729:Pigv UTSW 4 133664823 nonsense probably null
R6014:Pigv UTSW 4 133665429 missense probably benign 0.00
R6885:Pigv UTSW 4 133665481 missense probably damaging 0.99
R7638:Pigv UTSW 4 133665451 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CAGAACTGGATGTAGGCACG -3'
(R):5'- CAGTGGCACTCCATGACTTG -3'

Sequencing Primer
(F):5'- CTGGATGTAGGCACGATACTG -3'
(R):5'- GCACTCCATGACTTGGGTTGTC -3'
Posted On2018-04-27