Incidental Mutation 'R6343:Srrd'
ID513997
Institutional Source Beutler Lab
Gene Symbol Srrd
Ensembl Gene ENSMUSG00000029346
Gene NameSRR1 domain containing
SynonymsSrr1, 2810002G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location112337392-112343040 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 112340000 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 104 (A104G)
Ref Sequence ENSEMBL: ENSMUSP00000119870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000031289] [ENSMUST00000035279] [ENSMUST00000112359] [ENSMUST00000146510]
Predicted Effect probably benign
Transcript: ENSMUST00000031288
SMART Domains Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
Pfam:TIP_N 17 114 1.4e-30 PFAM
G_patch 148 194 3.3e-18 SMART
low complexity region 212 218 N/A INTRINSIC
low complexity region 228 242 N/A INTRINSIC
Pfam:GCFC 398 667 3.4e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031289
AA Change: A105G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346
AA Change: A105G

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035279
SMART Domains Protein: ENSMUSP00000047920
Gene: ENSMUSG00000042328

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112359
SMART Domains Protein: ENSMUSP00000107978
Gene: ENSMUSG00000042328

DomainStartEndE-ValueType
low complexity region 171 180 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133708
Predicted Effect probably benign
Transcript: ENSMUST00000146510
AA Change: A104G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346
AA Change: A104G

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176737
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Srrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0245:Srrd UTSW 5 112337528 utr 3 prime probably benign
R2038:Srrd UTSW 5 112338450 missense probably benign 0.12
R2162:Srrd UTSW 5 112342944 unclassified probably benign
R2172:Srrd UTSW 5 112341122 missense possibly damaging 0.95
R2246:Srrd UTSW 5 112339756 missense probably damaging 1.00
R7226:Srrd UTSW 5 112337456 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACCCAGCAGTGACTTCTG -3'
(R):5'- GGCTTCTTTCACAGTCCTGG -3'

Sequencing Primer
(F):5'- AGCAGTGACTTCTGGGGAC -3'
(R):5'- TCACAGTCCTGGCTCCAG -3'
Posted On2018-04-27