Mutagenetix > Incidental Mutation

Incidental Mutation 'R6343:Rsf1'

514004

Institutional Source

Beutler Lab

Gene Symbol

Rsf1

Ensembl Gene

ENSMUSG00000035623

Gene Name

remodeling and spacing factor 1

Synonyms

p325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6343 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97579889-97692778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97660917 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 285 (K285E)

Ref Sequence

ENSEMBL: ENSMUSP00000102771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107153] [ENSMUST00000123731]

AlphaFold

E9PWW9

Predicted Effect

probably benign
Transcript: ENSMUST00000107153
AA Change: K285E

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623
AA Change: K285E

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
Pfam:WHIM1	88	138	2.2e-10	PFAM
Pfam:WHIM2	140	172	9.4e-8	PFAM
Pfam:WHIM3	178	398	2.5e-27	PFAM
low complexity region	743	758	N/A	INTRINSIC
low complexity region	845	859	N/A	INTRINSIC
low complexity region	863	872	N/A	INTRINSIC
PHD	881	927	1.57e-11	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	971	993	N/A	INTRINSIC
low complexity region	1011	1030	N/A	INTRINSIC
low complexity region	1072	1096	N/A	INTRINSIC
low complexity region	1110	1128	N/A	INTRINSIC
low complexity region	1133	1152	N/A	INTRINSIC
low complexity region	1160	1190	N/A	INTRINSIC
low complexity region	1192	1198	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1268	1280	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123731

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155074

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156060

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206866

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,314,552	L301Q	probably damaging	Het
Adgrl4	T	C	3: 151,517,806	L632P	probably damaging	Het
Cacna2d1	T	A	5: 16,322,564	I539N	probably benign	Het
Camta1	T	A	4: 151,079,849	H314L	probably damaging	Het
Car2	T	C	3: 14,887,965	S56P	probably damaging	Het
Chrm5	G	A	2: 112,479,448	A441V	probably damaging	Het
Ckap5	T	A	2: 91,596,474	N1380K	possibly damaging	Het
Cspg4	T	C	9: 56,892,692	V1580A	probably benign	Het
Dcc	A	G	18: 71,336,035	L1099P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Epha5	A	T	5: 84,106,747	H644Q	probably damaging	Het
Eya3	T	C	4: 132,672,910	I80T	probably damaging	Het
Fdft1	A	T	14: 63,151,272	Y304N	probably damaging	Het
Fiz1	C	T	7: 5,008,401	A373T	possibly damaging	Het
Gpatch2l	T	A	12: 86,260,605	Y252*	probably null	Het
Hivep1	G	T	13: 42,159,671	G1796*	probably null	Het
Irf8	T	C	8: 120,753,707	V228A	probably damaging	Het
Islr	A	C	9: 58,157,096	V376G	probably damaging	Het
Kdm5a	T	C	6: 120,382,933	V230A	probably benign	Het
Lpgat1	A	G	1: 191,776,572		probably null	Het
Lrp8	T	C	4: 107,869,156		probably null	Het
Lyzl4	A	C	9: 121,578,084	S127A	possibly damaging	Het
Map4k1	T	C	7: 29,000,290	V606A	possibly damaging	Het
Mau2	T	A	8: 70,031,523	K138N	probably damaging	Het
Meikin	T	C	11: 54,370,766	L33P	probably damaging	Het
Mrpl28	T	C	17: 26,126,278	V224A	probably benign	Het
Ncdn	T	C	4: 126,747,171	D512G	possibly damaging	Het
Nlrp2	T	A	7: 5,300,926	Q200L	possibly damaging	Het
Nup98	T	C	7: 102,194,750	N89S	possibly damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	G	T	19: 12,919,582	H242Q	probably damaging	Het
Olfr304	T	A	7: 86,385,851	R270*	probably null	Het
Olfr551	A	G	7: 102,588,546	C66R	probably damaging	Het
Olfr770	A	T	10: 129,133,666	L34*	probably null	Het
Padi3	C	T	4: 140,803,508	V68I	possibly damaging	Het
Pign	A	T	1: 105,585,095	M621K	probably benign	Het
Pigv	C	T	4: 133,665,236	V208M	probably damaging	Het
Ripk4	A	G	16: 97,763,526		probably benign	Het
Serpina3k	G	C	12: 104,345,303	G380A	probably benign	Het
Sorbs1	A	G	19: 40,376,982		probably null	Het
Srrd	G	C	5: 112,340,000	A104G	probably benign	Het
Tbp	T	A	17: 15,501,089		probably null	Het
Tecrl	G	A	5: 83,294,600	H209Y	probably damaging	Het
Tmprss11c	A	G	5: 86,256,345	L157P	probably damaging	Het
Tmprss13	A	T	9: 45,343,200	T422S	possibly damaging	Het
Ttll5	A	G	12: 85,956,699	H1103R	probably benign	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Vldlr	A	G	19: 27,245,649	Y699C	probably damaging	Het
Vmn1r22	T	G	6: 57,900,578	N138T	possibly damaging	Het

Other mutations in Rsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Rsf1	APN	7	97681889	critical splice donor site	probably null	0.00
IGL01160:Rsf1	APN	7	97685584	missense	probably damaging	1.00
IGL01780:Rsf1	APN	7	97664770	critical splice donor site	probably benign	0.00
IGL01960:Rsf1	APN	7	97661575	missense	probably benign	0.00
IGL02487:Rsf1	APN	7	97639491	missense	probably damaging	0.99
IGL02814:Rsf1	APN	7	97661227	missense	probably damaging	1.00
IGL02972:Rsf1	APN	7	97661326	missense	probably benign	0.35
IGL03176:Rsf1	APN	7	97679150	splice site	probably benign
IGL03256:Rsf1	APN	7	97679004	missense	possibly damaging	0.82
BB011:Rsf1	UTSW	7	97579909	unclassified	probably benign
BB014:Rsf1	UTSW	7	97579924	unclassified	probably benign
BB018:Rsf1	UTSW	7	97579909	unclassified	probably benign
FR4976:Rsf1	UTSW	7	97579909	unclassified	probably benign
G1Funyon:Rsf1	UTSW	7	97661925	missense
P0023:Rsf1	UTSW	7	97662271	missense	probably damaging	1.00
R0144:Rsf1	UTSW	7	97636407	missense	probably damaging	1.00
R0380:Rsf1	UTSW	7	97579905	unclassified	probably benign
R0392:Rsf1	UTSW	7	97679005	missense	probably benign	0.00
R0422:Rsf1	UTSW	7	97680817	missense	probably benign	0.04
R0584:Rsf1	UTSW	7	97662128	missense	possibly damaging	0.60
R0636:Rsf1	UTSW	7	97662019	missense	possibly damaging	0.74
R0729:Rsf1	UTSW	7	97679027	missense	probably damaging	1.00
R0755:Rsf1	UTSW	7	97579967	missense	probably damaging	1.00
R0947:Rsf1	UTSW	7	97669778	missense	probably damaging	1.00
R1278:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1376:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1376:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1498:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1525:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1534:Rsf1	UTSW	7	97579909	unclassified	probably benign
R1582:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1591:Rsf1	UTSW	7	97639313	nonsense	probably null
R1676:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1695:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1710:Rsf1	UTSW	7	97662349	missense	possibly damaging	0.50
R1722:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1764:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579906	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1823:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1864:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1884:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1897:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1915:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1928:Rsf1	UTSW	7	97579909	unclassified	probably benign
R1958:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1962:Rsf1	UTSW	7	97579906	unclassified	probably benign
R1962:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1996:Rsf1	UTSW	7	97664632	missense	probably damaging	1.00
R1999:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2021:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2022:Rsf1	UTSW	7	97579910	unclassified	probably benign
R2046:Rsf1	UTSW	7	97661677	missense	probably benign	0.00
R2048:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2093:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2103:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2137:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2167:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2179:Rsf1	UTSW	7	97579909	unclassified	probably benign
R2191:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2207:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2211:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2241:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2264:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2283:Rsf1	UTSW	7	97579909	unclassified	probably benign
R2297:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2307:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2419:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2442:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2696:Rsf1	UTSW	7	97579933	unclassified	probably benign
R2764:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2939:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2965:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2972:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3008:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3013:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3026:Rsf1	UTSW	7	97579909	unclassified	probably benign
R3110:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3147:Rsf1	UTSW	7	97579908	unclassified	probably benign
R3427:Rsf1	UTSW	7	97579907	unclassified	probably benign
R3610:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R3624:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3753:Rsf1	UTSW	7	97662152	missense	probably benign	0.00
R3759:Rsf1	UTSW	7	97579909	unclassified	probably benign
R3780:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3794:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3889:Rsf1	UTSW	7	97579906	unclassified	probably benign
R3925:Rsf1	UTSW	7	97579907	unclassified	probably benign
R3964:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4037:Rsf1	UTSW	7	97579904	unclassified	probably benign
R4057:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4057:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4084:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4240:Rsf1	UTSW	7	97579935	unclassified	probably benign
R4303:Rsf1	UTSW	7	97579920	unclassified	probably benign
R4383:Rsf1	UTSW	7	97685476	missense	possibly damaging	0.86
R4492:Rsf1	UTSW	7	97579923	unclassified	probably benign
R4525:Rsf1	UTSW	7	97579926	unclassified	probably benign
R4530:Rsf1	UTSW	7	97579923	unclassified	probably benign
R4543:Rsf1	UTSW	7	97579922	unclassified	probably benign
R4629:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4629:Rsf1	UTSW	7	97579908	unclassified	probably benign
R4632:Rsf1	UTSW	7	97579904	unclassified	probably benign
R4633:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4652:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4675:Rsf1	UTSW	7	97579910	unclassified	probably benign
R4675:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R4677:Rsf1	UTSW	7	97680773	missense	possibly damaging	0.82
R4678:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4769:Rsf1	UTSW	7	97676222	missense	probably damaging	1.00
R4774:Rsf1	UTSW	7	97579916	unclassified	probably benign
R4820:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4917:Rsf1	UTSW	7	97662405	missense	probably damaging	1.00
R4918:Rsf1	UTSW	7	97662405	missense	probably damaging	1.00
R4977:Rsf1	UTSW	7	97579916	unclassified	probably benign
R4979:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4994:Rsf1	UTSW	7	97579909	unclassified	probably benign
R4994:Rsf1	UTSW	7	97579923	unclassified	probably benign
R5041:Rsf1	UTSW	7	97579925	unclassified	probably benign
R5125:Rsf1	UTSW	7	97661872	missense	possibly damaging	0.87
R5178:Rsf1	UTSW	7	97661872	missense	possibly damaging	0.87
R5306:Rsf1	UTSW	7	97579929	unclassified	probably benign
R5369:Rsf1	UTSW	7	97579904	unclassified	probably benign
R5371:Rsf1	UTSW	7	97579913	unclassified	probably benign
R5403:Rsf1	UTSW	7	97579907	unclassified	probably benign
R5436:Rsf1	UTSW	7	97579931	unclassified	probably benign
R5450:Rsf1	UTSW	7	97579908	unclassified	probably benign
R5532:Rsf1	UTSW	7	97680695	missense	probably damaging	1.00
R5587:Rsf1	UTSW	7	97662121	missense	probably benign	0.02
R5657:Rsf1	UTSW	7	97579934	unclassified	probably benign
R5689:Rsf1	UTSW	7	97579934	unclassified	probably benign
R5745:Rsf1	UTSW	7	97579920	unclassified	probably benign
R5748:Rsf1	UTSW	7	97579928	unclassified	probably benign
R5773:Rsf1	UTSW	7	97579933	unclassified	probably benign
R5859:Rsf1	UTSW	7	97685559	missense	probably damaging	1.00
R5938:Rsf1	UTSW	7	97685559	missense	probably damaging	1.00
R6001:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6001:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6001:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6021:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6025:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6030:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6030:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6035:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6035:Rsf1	UTSW	7	97662109	missense	probably benign	0.01
R6035:Rsf1	UTSW	7	97662109	missense	probably benign	0.01
R6035:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6036:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6037:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6037:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6073:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6077:Rsf1	UTSW	7	97579928	unclassified	probably benign
R6102:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6111:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6126:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6128:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6130:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6154:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6154:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6165:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6166:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6182:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6189:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6200:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6210:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6212:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6214:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6215:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6216:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6232:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6235:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6242:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6243:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6244:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6268:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6269:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6273:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6275:Rsf1	UTSW	7	97579923	unclassified	probably benign
R6286:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6291:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6293:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6297:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6302:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6309:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6312:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6324:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6346:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6356:Rsf1	UTSW	7	97661934	missense	probably benign
R6370:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6377:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6377:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6378:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6394:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6398:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6406:Rsf1	UTSW	7	97579926	unclassified	probably benign
R6413:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6443:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6453:Rsf1	UTSW	7	97579917	unclassified	probably benign
R6471:Rsf1	UTSW	7	97579914	unclassified	probably benign
R6473:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6497:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6505:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6561:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6572:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6607:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6611:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6622:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6626:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6636:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6647:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6648:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6669:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6673:Rsf1	UTSW	7	97579918	unclassified	probably benign
R6679:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6685:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6694:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6694:Rsf1	UTSW	7	97579928	unclassified	probably benign
R6695:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6697:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6726:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6739:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6747:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6751:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6771:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6773:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6787:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6800:Rsf1	UTSW	7	97579932	unclassified	probably benign
R6804:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6806:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6815:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6820:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6823:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6829:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6861:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6862:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6869:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6875:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6889:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6897:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6960:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6963:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6967:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6969:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6977:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6996:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7066:Rsf1	UTSW	7	97579918	unclassified	probably benign
R7109:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7127:Rsf1	UTSW	7	97579914	unclassified	probably benign
R7138:Rsf1	UTSW	7	97669795	missense
R7214:Rsf1	UTSW	7	97579929	unclassified	probably benign
R7217:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7238:Rsf1	UTSW	7	97579921	unclassified	probably benign
R7246:Rsf1	UTSW	7	97579922	unclassified	probably benign
R7253:Rsf1	UTSW	7	97579915	unclassified	probably benign
R7294:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7305:Rsf1	UTSW	7	97579918	unclassified	probably benign
R7309:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7352:Rsf1	UTSW	7	97579926	unclassified	probably benign
R7380:Rsf1	UTSW	7	97579915	unclassified	probably benign
R7393:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7395:Rsf1	UTSW	7	97579926	unclassified	probably benign
R7411:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7413:Rsf1	UTSW	7	97579921	unclassified	probably benign
R7481:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7538:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7541:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7545:Rsf1	UTSW	7	97579927	unclassified	probably benign
R7574:Rsf1	UTSW	7	97661167	missense
R7578:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7599:Rsf1	UTSW	7	97579904	unclassified	probably benign
R7630:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7632:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7710:Rsf1	UTSW	7	97681834	missense
R7711:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7715:Rsf1	UTSW	7	97579912	unclassified	probably benign
R7719:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7722:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7729:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7734:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7743:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7761:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7764:Rsf1	UTSW	7	97579927	unclassified	probably benign
R7797:Rsf1	UTSW	7	97661485	missense
R7802:Rsf1	UTSW	7	97661772	missense
R7806:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7821:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7823:Rsf1	UTSW	7	97579907	unclassified	probably benign
R7824:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7825:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7826:Rsf1	UTSW	7	97661161	unclassified	probably benign
R7841:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R7854:Rsf1	UTSW	7	97579924	unclassified	probably benign
R7862:Rsf1	UTSW	7	97579923	unclassified	probably benign
R7893:Rsf1	UTSW	7	97661958	missense
R7923:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7924:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7927:Rsf1	UTSW	7	97579924	unclassified	probably benign
R7931:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7951:Rsf1	UTSW	7	97579912	unclassified	probably benign
R7957:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7960:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7979:Rsf1	UTSW	7	97685713	missense
R7982:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7991:Rsf1	UTSW	7	97661333	missense
R8028:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8030:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8042:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8062:Rsf1	UTSW	7	97677387	missense
R8076:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8117:Rsf1	UTSW	7	97639257	splice site	probably null
R8132:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8153:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8155:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8166:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8197:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8235:Rsf1	UTSW	7	97676254	utr 3 prime	probably benign
R8245:Rsf1	UTSW	7	97579915	unclassified	probably benign
R8282:Rsf1	UTSW	7	97579920	frame shift	probably null
R8301:Rsf1	UTSW	7	97661925	missense
R8315:Rsf1	UTSW	7	97579923	unclassified	probably benign
R8343:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8370:Rsf1	UTSW	7	97579929	unclassified	probably benign
R8372:Rsf1	UTSW	7	97662417	missense
R8376:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8382:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8392:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8410:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8443:Rsf1	UTSW	7	97616896	missense
R8502:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8529:Rsf1	UTSW	7	97670867	utr 3 prime	probably benign
R8537:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8554:Rsf1	UTSW	7	97579923	unclassified	probably benign
R8558:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8735:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8742:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8772:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8862:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8866:Rsf1	UTSW	7	97579913	unclassified	probably benign
R8889:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8889:Rsf1	UTSW	7	97678964	missense
R8891:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8892:Rsf1	UTSW	7	97678964	missense
R8907:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8907:Rsf1	UTSW	7	97579918	unclassified	probably benign
R8913:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8916:Rsf1	UTSW	7	97579933	unclassified	probably benign
R8924:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8940:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8946:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8947:Rsf1	UTSW	7	97681852	unclassified	probably benign
R8951:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8975:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9033:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9044:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9060:Rsf1	UTSW	7	97579923	unclassified	probably benign
R9066:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9079:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9080:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R9094:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9096:Rsf1	UTSW	7	97579907	unclassified	probably benign
R9101:Rsf1	UTSW	7	97579907	unclassified	probably benign
R9102:Rsf1	UTSW	7	97579931	unclassified	probably benign
R9123:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9125:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9126:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9128:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9157:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9159:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9161:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9187:Rsf1	UTSW	7	97579933	unclassified	probably benign
R9240:Rsf1	UTSW	7	97579912	unclassified	probably benign
R9250:Rsf1	UTSW	7	97579914	unclassified	probably benign
R9257:Rsf1	UTSW	7	97685711	missense
R9288:Rsf1	UTSW	7	97579912	unclassified	probably benign
R9345:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9406:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9411:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R9414:Rsf1	UTSW	7	97664558	critical splice acceptor site	probably null
R9420:Rsf1	UTSW	7	97579927	unclassified	probably benign
R9421:Rsf1	UTSW	7	97579934	unclassified	probably benign
R9423:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9427:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9448:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9452:Rsf1	UTSW	7	97579926	unclassified	probably benign
R9454:Rsf1	UTSW	7	97579923	unclassified	probably benign
R9467:Rsf1	UTSW	7	97579913	unclassified	probably benign
R9468:Rsf1	UTSW	7	97579920	unclassified	probably benign
R9483:Rsf1	UTSW	7	97579930	unclassified	probably benign
R9488:Rsf1	UTSW	7	97579922	unclassified	probably benign
R9502:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9507:Rsf1	UTSW	7	97579934	unclassified	probably benign
R9509:Rsf1	UTSW	7	97579920	unclassified	probably benign
R9519:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9526:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9537:Rsf1	UTSW	7	97579914	unclassified	probably benign
R9581:Rsf1	UTSW	7	97579918	unclassified	probably benign
R9590:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9592:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9618:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9630:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9685:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9716:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9748:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9774:Rsf1	UTSW	7	97579931	unclassified	probably benign
R9795:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9802:Rsf1	UTSW	7	97579906	unclassified	probably benign
RF034:Rsf1	UTSW	7	97579908	unclassified	probably benign
RF036:Rsf1	UTSW	7	97579908	unclassified	probably benign
X0025:Rsf1	UTSW	7	97636444	missense	probably damaging	1.00
X0028:Rsf1	UTSW	7	97660824	nonsense	probably null
Y4335:Rsf1	UTSW	7	97579904	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCAGTTACAACAGGCTTCATATTG -3'
(R):5'- TTGCTACCAAAGTCGGCTCG -3'

Sequencing Primer
(F):5'- GTTCTGGTTTTAGAAGCATCA -3'
(R):5'- TACCAAAGTCGGCTCGCTCAG -3'

Posted On

2018-04-27