Mutagenetix > Incidental Mutations

Incidental Mutation 'R6343:Irf8'

514008

Institutional Source

Beutler Lab

Gene Symbol

Irf8

Ensembl Gene

ENSMUSG00000041515

Gene Name

interferon regulatory factor 8

Synonyms

Icsbp1, ICSBP, Myls, IRF-8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6343 (G1)

Quality Score

223.009

Status

Validated

Chromosome

Chromosomal Location

120736358-120756694 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120753707 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 228 (V228A)

Ref Sequence

ENSEMBL: ENSMUSP00000125447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047737] [ENSMUST00000127664] [ENSMUST00000160943] [ENSMUST00000162001] [ENSMUST00000162658]

Predicted Effect

probably benign
Transcript: ENSMUST00000047737
AA Change: V319A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000040245
Gene: ENSMUSG00000041515
AA Change: V319A

Domain	Start	End	E-Value	Type
IRF	3	115	8.69e-65	SMART
Blast:IRF	129	176	7e-11	BLAST
IRF-3	202	380	2.63e-78	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160594

Predicted Effect

probably damaging
Transcript: ENSMUST00000160943
AA Change: V228A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125447
Gene: ENSMUSG00000041515
AA Change: V228A

Domain	Start	End	E-Value	Type
IRF	3	85	2.54e-16	SMART
IRF-3	111	289	2.63e-78	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162001
AA Change: V319A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125029
Gene: ENSMUSG00000041515
AA Change: V319A

Domain	Start	End	E-Value	Type
IRF	3	115	8.69e-65	SMART
Blast:IRF	129	176	7e-11	BLAST
IRF-3	202	380	2.63e-78	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162658

SMART Domains

Protein: ENSMUSP00000125443
Gene: ENSMUSG00000041515

Domain	Start	End	E-Value	Type
IRF	3	85	2.54e-16	SMART
Pfam:IRF-3	111	151	4.7e-9	PFAM

Meta Mutation Damage Score

0.3053

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a transcription factor that belongs to the interferon regulatory factor family. Proteins belonging to this family have a DNA binding domain at the amino terminus that contains five well-conserved tryptophan-rich repeats. This domain recognizes DNA sequences similar to the interferon-stimulated response element. The protein encoded by this gene promotes or suppresses lineage-specific genes to regulate the differentation of lymphoid and myeloid lineage cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased incidence of viral infections, shortened life span, deregulated hematopoiesis, and hematological neoplasias. Heterozygotes show similar, but milder, phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,314,552	L301Q	probably damaging	Het
Adgrl4	T	C	3: 151,517,806	L632P	probably damaging	Het
Cacna2d1	T	A	5: 16,322,564	I539N	probably benign	Het
Camta1	T	A	4: 151,079,849	H314L	probably damaging	Het
Car2	T	C	3: 14,887,965	S56P	probably damaging	Het
Chrm5	G	A	2: 112,479,448	A441V	probably damaging	Het
Ckap5	T	A	2: 91,596,474	N1380K	possibly damaging	Het
Cspg4	T	C	9: 56,892,692	V1580A	probably benign	Het
Dcc	A	G	18: 71,336,035	L1099P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Epha5	A	T	5: 84,106,747	H644Q	probably damaging	Het
Eya3	T	C	4: 132,672,910	I80T	probably damaging	Het
Fdft1	A	T	14: 63,151,272	Y304N	probably damaging	Het
Fiz1	C	T	7: 5,008,401	A373T	possibly damaging	Het
Gpatch2l	T	A	12: 86,260,605	Y252*	probably null	Het
Hivep1	G	T	13: 42,159,671	G1796*	probably null	Het
Islr	A	C	9: 58,157,096	V376G	probably damaging	Het
Kdm5a	T	C	6: 120,382,933	V230A	probably benign	Het
Lpgat1	A	G	1: 191,776,572		probably null	Het
Lrp8	T	C	4: 107,869,156		probably null	Het
Lyzl4	A	C	9: 121,578,084	S127A	possibly damaging	Het
Map4k1	T	C	7: 29,000,290	V606A	possibly damaging	Het
Mau2	T	A	8: 70,031,523	K138N	probably damaging	Het
Meikin	T	C	11: 54,370,766	L33P	probably damaging	Het
Mrpl28	T	C	17: 26,126,278	V224A	probably benign	Het
Ncdn	T	C	4: 126,747,171	D512G	possibly damaging	Het
Nlrp2	T	A	7: 5,300,926	Q200L	possibly damaging	Het
Nup98	T	C	7: 102,194,750	N89S	possibly damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	G	T	19: 12,919,582	H242Q	probably damaging	Het
Olfr304	T	A	7: 86,385,851	R270*	probably null	Het
Olfr551	A	G	7: 102,588,546	C66R	probably damaging	Het
Olfr770	A	T	10: 129,133,666	L34*	probably null	Het
Padi3	C	T	4: 140,803,508	V68I	possibly damaging	Het
Pign	A	T	1: 105,585,095	M621K	probably benign	Het
Pigv	C	T	4: 133,665,236	V208M	probably damaging	Het
Ripk4	A	G	16: 97,763,526		probably null	Het
Rsf1	A	G	7: 97,660,917	K285E	probably benign	Het
Serpina3k	G	C	12: 104,345,303	G380A	probably benign	Het
Sorbs1	A	G	19: 40,376,982		probably null	Het
Srrd	G	C	5: 112,340,000	A104G	probably benign	Het
Tbp	T	A	17: 15,501,089		probably null	Het
Tecrl	G	A	5: 83,294,600	H209Y	probably damaging	Het
Tmprss11c	A	G	5: 86,256,345	L157P	probably damaging	Het
Tmprss13	A	T	9: 45,343,200	T422S	possibly damaging	Het
Ttll5	A	G	12: 85,956,699	H1103R	probably benign	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Vldlr	A	G	19: 27,245,649	Y699C	probably damaging	Het
Vmn1r22	T	G	6: 57,900,578	N138T	possibly damaging	Het

Other mutations in Irf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01314:Irf8	APN	8	120753380	missense	probably damaging	1.00
IGL02944:Irf8	APN	8	120755125	missense	probably benign	0.00
IGL03024:Irf8	APN	8	120753358	missense	probably damaging	0.98
gemini	UTSW	8	120743883	nonsense	probably null
gemini2	UTSW	8	120753707	missense	probably damaging	0.97
glenn	UTSW	8	120739842	missense	probably damaging	1.00
ANU74:Irf8	UTSW	8	120739869	missense	possibly damaging	0.75
R0211:Irf8	UTSW	8	120739975	missense	probably damaging	1.00
R0211:Irf8	UTSW	8	120739975	missense	probably damaging	1.00
R0840:Irf8	UTSW	8	120753481	missense	probably benign	0.06
R1622:Irf8	UTSW	8	120739822	missense	possibly damaging	0.86
R1715:Irf8	UTSW	8	120754388	missense	probably damaging	0.98
R2274:Irf8	UTSW	8	120753527	missense	probably damaging	0.99
R2875:Irf8	UTSW	8	120754463	missense	probably damaging	1.00
R3743:Irf8	UTSW	8	120753571	missense	probably damaging	1.00
R4209:Irf8	UTSW	8	120753469	missense	probably damaging	0.99
R4729:Irf8	UTSW	8	120753439	missense	probably damaging	0.99
R6950:Irf8	UTSW	8	120755125	missense	probably benign	0.00
R7051:Irf8	UTSW	8	120739842	missense	probably damaging	1.00
R7052:Irf8	UTSW	8	120739842	missense	probably damaging	1.00
R7249:Irf8	UTSW	8	120739832	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCTGCCTAAGTTGTATGGGC -3'
(R):5'- TGCTGTCCTTATACCGAGGG -3'

Sequencing Primer
(F):5'- GAACCCGTGTGCTTTCCGAC -3'
(R):5'- AGGCAGGCTAGGCTTCCAAG -3'

Posted On

2018-04-27