Incidental Mutation 'R6343:Tmprss13'
ID514010
Institutional Source Beutler Lab
Gene Symbol Tmprss13
Ensembl Gene ENSMUSG00000037129
Gene Nametransmembrane protease, serine 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45319100-45347581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45343200 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 422 (T422S)
Ref Sequence ENSEMBL: ENSMUSP00000034597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034597
AA Change: T422S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034597
Gene: ENSMUSG00000037129
AA Change: T422S

DomainStartEndE-ValueType
low complexity region 15 99 N/A INTRINSIC
low complexity region 114 128 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
LDLa 171 209 2.38e-1 SMART
SR 208 296 5.67e-4 SMART
Tryp_SPc 306 535 1.53e-93 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease family. Transmembrane serine proteases are regulated by protease inhibitors and known to function in development, homeostasis, infection, and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and outwardly healthy but exhibit abnormal stratum corneum formation leading to impaired skin barrier function, as measured by the transepidermal fluid loss rate in newborn pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Tmprss13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tmprss13 APN 9 45336105 missense probably damaging 0.99
IGL02112:Tmprss13 APN 9 45339404 missense probably damaging 1.00
IGL02116:Tmprss13 APN 9 45333674 missense probably benign
IGL02669:Tmprss13 APN 9 45332526 missense probably benign 0.18
IGL02961:Tmprss13 APN 9 45345003 missense probably damaging 1.00
FR4449:Tmprss13 UTSW 9 45328558 missense unknown
R0233:Tmprss13 UTSW 9 45337100 splice site probably benign
R0271:Tmprss13 UTSW 9 45333688 splice site probably benign
R0415:Tmprss13 UTSW 9 45337132 intron probably null
R0742:Tmprss13 UTSW 9 45332467 missense probably damaging 0.98
R1178:Tmprss13 UTSW 9 45328647 missense unknown
R1447:Tmprss13 UTSW 9 45328580 missense unknown
R1493:Tmprss13 UTSW 9 45336107 missense probably benign 0.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1574:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R1599:Tmprss13 UTSW 9 45338318 missense probably damaging 1.00
R2007:Tmprss13 UTSW 9 45332545 missense probably damaging 1.00
R2093:Tmprss13 UTSW 9 45345042 missense probably damaging 0.99
R5666:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R5670:Tmprss13 UTSW 9 45344955 missense probably damaging 0.99
R6273:Tmprss13 UTSW 9 45345332 missense probably damaging 1.00
R6583:Tmprss13 UTSW 9 45345305 missense probably damaging 1.00
R6671:Tmprss13 UTSW 9 45343231 missense probably damaging 1.00
R6777:Tmprss13 UTSW 9 45336101 nonsense probably null
R7135:Tmprss13 UTSW 9 45338345 missense probably damaging 1.00
R7468:Tmprss13 UTSW 9 45328423 missense unknown
R7617:Tmprss13 UTSW 9 45333560 nonsense probably null
S24628:Tmprss13 UTSW 9 45337132 intron probably null
Predicted Primers PCR Primer
(F):5'- GGCCCACTGATTGCTGAAAG -3'
(R):5'- AGCCTTCATCTGCATACCAC -3'

Sequencing Primer
(F):5'- GGTTCAGATGAAATGACTGACTTGC -3'
(R):5'- TCATCTGCATACCACACTTATATACG -3'
Posted On2018-04-27