Mutagenetix > Incidental Mutations

Incidental Mutation 'R6343:Cspg4'

514011

Institutional Source

Beutler Lab

Gene Symbol

Cspg4

Ensembl Gene

ENSMUSG00000032911

Gene Name

chondroitin sulfate proteoglycan 4

Synonyms

AN2, 4732461B14Rik, NG2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6343 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56865033-56899870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56892692 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1580 (V1580A)

Ref Sequence

ENSEMBL: ENSMUSP00000038909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035661]

Predicted Effect

probably benign
Transcript: ENSMUST00000035661
AA Change: V1580A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: V1580A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
LamG	47	179	9.16e-22	SMART
LamG	223	364	3.52e-23	SMART
low complexity region	384	397	N/A	INTRINSIC
Pfam:Cadherin_3	495	646	1e-36	PFAM
Pfam:Cadherin_3	732	885	7.9e-14	PFAM
Pfam:Cadherin_3	868	996	7e-15	PFAM
Pfam:Cadherin_3	972	1115	9e-26	PFAM
Pfam:Cadherin_3	1116	1223	1.1e-10	PFAM
Pfam:Cadherin_3	1225	1344	3.3e-12	PFAM
Pfam:Cadherin_3	1425	1568	6.3e-52	PFAM
Pfam:Cadherin_3	1578	1684	9.7e-9	PFAM
Pfam:Cadherin_3	1674	1809	3.2e-9	PFAM
Pfam:Cadherin_3	1779	1929	1.6e-31	PFAM
transmembrane domain	2229	2251	N/A	INTRINSIC
low complexity region	2295	2305	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217052

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,314,552	L301Q	probably damaging	Het
Adgrl4	T	C	3: 151,517,806	L632P	probably damaging	Het
Cacna2d1	T	A	5: 16,322,564	I539N	probably benign	Het
Camta1	T	A	4: 151,079,849	H314L	probably damaging	Het
Car2	T	C	3: 14,887,965	S56P	probably damaging	Het
Chrm5	G	A	2: 112,479,448	A441V	probably damaging	Het
Ckap5	T	A	2: 91,596,474	N1380K	possibly damaging	Het
Dcc	A	G	18: 71,336,035	L1099P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Epha5	A	T	5: 84,106,747	H644Q	probably damaging	Het
Eya3	T	C	4: 132,672,910	I80T	probably damaging	Het
Fdft1	A	T	14: 63,151,272	Y304N	probably damaging	Het
Fiz1	C	T	7: 5,008,401	A373T	possibly damaging	Het
Gpatch2l	T	A	12: 86,260,605	Y252*	probably null	Het
Hivep1	G	T	13: 42,159,671	G1796*	probably null	Het
Irf8	T	C	8: 120,753,707	V228A	probably damaging	Het
Islr	A	C	9: 58,157,096	V376G	probably damaging	Het
Kdm5a	T	C	6: 120,382,933	V230A	probably benign	Het
Lpgat1	A	G	1: 191,776,572		probably null	Het
Lrp8	T	C	4: 107,869,156		probably null	Het
Lyzl4	A	C	9: 121,578,084	S127A	possibly damaging	Het
Map4k1	T	C	7: 29,000,290	V606A	possibly damaging	Het
Mau2	T	A	8: 70,031,523	K138N	probably damaging	Het
Meikin	T	C	11: 54,370,766	L33P	probably damaging	Het
Mrpl28	T	C	17: 26,126,278	V224A	probably benign	Het
Ncdn	T	C	4: 126,747,171	D512G	possibly damaging	Het
Nlrp2	T	A	7: 5,300,926	Q200L	possibly damaging	Het
Nup98	T	C	7: 102,194,750	N89S	possibly damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	G	T	19: 12,919,582	H242Q	probably damaging	Het
Olfr304	T	A	7: 86,385,851	R270*	probably null	Het
Olfr551	A	G	7: 102,588,546	C66R	probably damaging	Het
Olfr770	A	T	10: 129,133,666	L34*	probably null	Het
Padi3	C	T	4: 140,803,508	V68I	possibly damaging	Het
Pign	A	T	1: 105,585,095	M621K	probably benign	Het
Pigv	C	T	4: 133,665,236	V208M	probably damaging	Het
Ripk4	A	G	16: 97,763,526		probably null	Het
Rsf1	A	G	7: 97,660,917	K285E	probably benign	Het
Serpina3k	G	C	12: 104,345,303	G380A	probably benign	Het
Sorbs1	A	G	19: 40,376,982		probably null	Het
Srrd	G	C	5: 112,340,000	A104G	probably benign	Het
Tbp	T	A	17: 15,501,089		probably null	Het
Tecrl	G	A	5: 83,294,600	H209Y	probably damaging	Het
Tmprss11c	A	G	5: 86,256,345	L157P	probably damaging	Het
Tmprss13	A	T	9: 45,343,200	T422S	possibly damaging	Het
Ttll5	A	G	12: 85,956,699	H1103R	probably benign	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Vldlr	A	G	19: 27,245,649	Y699C	probably damaging	Het
Vmn1r22	T	G	6: 57,900,578	N138T	possibly damaging	Het

Other mutations in Cspg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Cspg4	APN	9	56898865	missense	probably damaging	1.00
IGL01322:Cspg4	APN	9	56898588	missense	probably damaging	1.00
IGL01922:Cspg4	APN	9	56887887	missense	probably damaging	1.00
IGL01993:Cspg4	APN	9	56898478	missense	probably benign	0.09
IGL02379:Cspg4	APN	9	56892609	splice site	probably benign
IGL02398:Cspg4	APN	9	56886686	missense	probably benign	0.43
IGL02503:Cspg4	APN	9	56897403	missense	probably damaging	1.00
IGL02504:Cspg4	APN	9	56885772	missense	probably benign	0.06
IGL02692:Cspg4	APN	9	56887454	missense	probably benign	0.00
IGL02728:Cspg4	APN	9	56886481	missense	probably damaging	1.00
IGL02806:Cspg4	APN	9	56890259	missense	possibly damaging	0.57
IGL02886:Cspg4	APN	9	56897388	missense	probably damaging	0.99
IGL03005:Cspg4	APN	9	56888488	missense	probably damaging	1.00
IGL03008:Cspg4	APN	9	56898475	missense	possibly damaging	0.48
IGL03202:Cspg4	APN	9	56897739	missense	possibly damaging	0.93
chiclets	UTSW	9	56885222	splice site	probably null
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0254:Cspg4	UTSW	9	56897410	missense	probably damaging	0.98
R0284:Cspg4	UTSW	9	56886139	missense	probably damaging	0.96
R0513:Cspg4	UTSW	9	56898091	missense	probably benign	0.03
R0602:Cspg4	UTSW	9	56888017	missense	probably damaging	1.00
R0747:Cspg4	UTSW	9	56890280	missense	probably damaging	1.00
R1005:Cspg4	UTSW	9	56888736	missense	probably benign	0.13
R1421:Cspg4	UTSW	9	56896626	missense	probably benign	0.00
R1443:Cspg4	UTSW	9	56886512	missense	probably damaging	1.00
R1481:Cspg4	UTSW	9	56887810	missense	probably damaging	0.98
R1585:Cspg4	UTSW	9	56898867	missense	probably damaging	0.99
R1624:Cspg4	UTSW	9	56888470	missense	probably damaging	1.00
R1670:Cspg4	UTSW	9	56897403	missense	probably damaging	1.00
R1721:Cspg4	UTSW	9	56888743	missense	probably damaging	0.98
R1728:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1729:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1763:Cspg4	UTSW	9	56886979	missense	probably damaging	0.97
R1772:Cspg4	UTSW	9	56897492	missense	probably benign	0.02
R1938:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R1975:Cspg4	UTSW	9	56890478	missense	probably damaging	1.00
R2064:Cspg4	UTSW	9	56896656	missense	probably damaging	1.00
R2185:Cspg4	UTSW	9	56886972	missense	probably benign	0.37
R2252:Cspg4	UTSW	9	56898046	missense	probably damaging	1.00
R2291:Cspg4	UTSW	9	56892743	missense	probably damaging	0.96
R2329:Cspg4	UTSW	9	56888550	missense	probably benign	0.00
R3780:Cspg4	UTSW	9	56888233	missense	probably damaging	1.00
R3830:Cspg4	UTSW	9	56897621	missense	probably damaging	0.99
R3944:Cspg4	UTSW	9	56886123	missense	probably damaging	1.00
R4011:Cspg4	UTSW	9	56887317	missense	probably benign	0.19
R4115:Cspg4	UTSW	9	56898394	missense	probably damaging	1.00
R4173:Cspg4	UTSW	9	56887930	missense	probably damaging	1.00
R4243:Cspg4	UTSW	9	56887857	missense	probably benign	0.12
R4329:Cspg4	UTSW	9	56892465	missense	probably damaging	0.99
R4544:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4545:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4546:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4649:Cspg4	UTSW	9	56886865	missense	possibly damaging	0.93
R4663:Cspg4	UTSW	9	56886676	missense	possibly damaging	0.61
R4674:Cspg4	UTSW	9	56898205	missense	probably damaging	1.00
R4779:Cspg4	UTSW	9	56885808	missense	probably damaging	1.00
R4884:Cspg4	UTSW	9	56898069	missense	probably benign	0.00
R5021:Cspg4	UTSW	9	56897730	missense	probably benign	0.01
R5051:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
R5328:Cspg4	UTSW	9	56885856	missense	probably benign	0.01
R5394:Cspg4	UTSW	9	56890200	missense	probably damaging	1.00
R5567:Cspg4	UTSW	9	56886648	missense	probably benign	0.00
R5682:Cspg4	UTSW	9	56886196	missense	probably benign	0.14
R5690:Cspg4	UTSW	9	56898735	missense	probably benign	0.01
R5715:Cspg4	UTSW	9	56891051	missense	possibly damaging	0.90
R5717:Cspg4	UTSW	9	56885798	missense	probably benign
R5726:Cspg4	UTSW	9	56885904	missense	probably damaging	1.00
R5898:Cspg4	UTSW	9	56885222	splice site	probably null
R6140:Cspg4	UTSW	9	56897224	missense	probably benign	0.35
R6147:Cspg4	UTSW	9	56888772	missense	probably damaging	0.99
R6239:Cspg4	UTSW	9	56888182	missense	probably benign	0.04
R6351:Cspg4	UTSW	9	56892644	missense	probably benign	0.00
R6564:Cspg4	UTSW	9	56890158	missense	probably benign	0.02
R6814:Cspg4	UTSW	9	56890340	missense	possibly damaging	0.91
R6928:Cspg4	UTSW	9	56897880	missense	possibly damaging	0.95
R6967:Cspg4	UTSW	9	56890136	missense	possibly damaging	0.52
R6981:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R7033:Cspg4	UTSW	9	56888074	missense	probably damaging	0.96
R7419:Cspg4	UTSW	9	56888443	missense	possibly damaging	0.94
X0065:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
Z1088:Cspg4	UTSW	9	56886036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCGGGCCCAGAAGACTTG -3'
(R):5'- ACAGACTCTGTGAAGCATGGAG -3'

Sequencing Primer
(F):5'- TGCTGTTCTCACACAGAGG -3'
(R):5'- CATGGAGGAGCCTGTTAGC -3'

Posted On

2018-04-27