Incidental Mutation 'R6343:Mrpl28'
ID514023
Institutional Source Beutler Lab
Gene Symbol Mrpl28
Ensembl Gene ENSMUSG00000024181
Gene Namemitochondrial ribosomal protein L28
SynonymsMAAT1, p15, 1110015G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R6343 (G1)
Quality Score188.009
Status Validated
Chromosome17
Chromosomal Location26123520-26126613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26126278 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 224 (V224A)
Ref Sequence ENSEMBL: ENSMUSP00000025014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025010] [ENSMUST00000025014] [ENSMUST00000128597]
Predicted Effect probably benign
Transcript: ENSMUST00000025010
SMART Domains Protein: ENSMUSP00000025010
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
EGF 495 531 1.99e1 SMART
Pfam:DUF3522 541 725 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025014
AA Change: V224A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025014
Gene: ENSMUSG00000024181
AA Change: V224A

DomainStartEndE-ValueType
Pfam:Ribosomal_L28 77 138 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123132
Predicted Effect probably benign
Transcript: ENSMUST00000127647
SMART Domains Protein: ENSMUSP00000115369
Gene: ENSMUSG00000024181

DomainStartEndE-ValueType
PDB:4CE4|1 2 44 5e-19 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128597
SMART Domains Protein: ENSMUSP00000121651
Gene: ENSMUSG00000024180

DomainStartEndE-ValueType
EGF 3 39 1.99e1 SMART
Pfam:DUF3522 47 143 2e-36 PFAM
Pfam:DUF3522 134 194 2.6e-17 PFAM
Meta Mutation Damage Score 0.1078 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Mrpl28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Mrpl28 APN 17 26125515 missense probably damaging 1.00
R2269:Mrpl28 UTSW 17 26126311 missense probably benign 0.12
R7045:Mrpl28 UTSW 17 26126287 missense probably benign 0.13
R7468:Mrpl28 UTSW 17 26124615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGTGACCAAGGGAAAGC -3'
(R):5'- TGGCACAGAAGGGTTCTCTG -3'

Sequencing Primer
(F):5'- CCAAGGGAAAGCAGTCCTCTTTTG -3'
(R):5'- GGGTTCTCTGAAAAGTCTACCACAG -3'
Posted On2018-04-27