Incidental Mutation 'R6343:Olfr1448'
ID514025
Institutional Source Beutler Lab
Gene Symbol Olfr1448
Ensembl Gene ENSMUSG00000048456
Gene Nameolfactory receptor 1448
SynonymsMOR202-5, GA_x6K02T2RE5P-3249780-3248836
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12916661-12924419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12919582 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 242 (H242Q)
Ref Sequence ENSEMBL: ENSMUSP00000149296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054737] [ENSMUST00000213177] [ENSMUST00000213713] [ENSMUST00000216888]
Predicted Effect probably damaging
Transcript: ENSMUST00000054737
AA Change: H242Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055664
Gene: ENSMUSG00000048456
AA Change: H242Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.2e-54 PFAM
Pfam:7tm_1 39 288 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213177
AA Change: H242Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213713
AA Change: H242Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216888
AA Change: H242Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Olfr1448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1448 APN 19 12920126 missense probably damaging 1.00
IGL01730:Olfr1448 APN 19 12919562 missense probably damaging 1.00
IGL01901:Olfr1448 APN 19 12919583 missense probably damaging 0.98
IGL02055:Olfr1448 APN 19 12919566 missense possibly damaging 0.78
R0152:Olfr1448 UTSW 19 12920108 missense possibly damaging 0.49
R0311:Olfr1448 UTSW 19 12920096 missense possibly damaging 0.91
R0349:Olfr1448 UTSW 19 12919935 missense probably damaging 1.00
R1873:Olfr1448 UTSW 19 12919488 missense probably damaging 1.00
R2371:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R3548:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R4697:Olfr1448 UTSW 19 12919934 missense probably damaging 0.99
R5482:Olfr1448 UTSW 19 12919905 missense probably damaging 0.96
R5748:Olfr1448 UTSW 19 12920015 missense probably damaging 1.00
R5749:Olfr1448 UTSW 19 12920225 missense probably benign 0.02
R5795:Olfr1448 UTSW 19 12919824 missense possibly damaging 0.95
R5952:Olfr1448 UTSW 19 12919830 missense probably benign 0.00
R6228:Olfr1448 UTSW 19 12919937 missense probably damaging 1.00
R6273:Olfr1448 UTSW 19 12919400 missense probably benign 0.02
R6341:Olfr1448 UTSW 19 12919479 missense probably benign 0.29
R6454:Olfr1448 UTSW 19 12920031 missense probably benign 0.10
R7666:Olfr1448 UTSW 19 12920162 missense probably damaging 0.99
R7810:Olfr1448 UTSW 19 12919865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACTCTATGGGATGGTTAGCC -3'
(R):5'- ATCGTGCTCAGACACCTATATCAG -3'

Sequencing Primer
(F):5'- AGCAAATGAAGTTGTCTTATCACAG -3'
(R):5'- CAGACACCTATATCAGTGAGACTGTG -3'
Posted On2018-04-27