Incidental Mutation 'R6344:Tcaf3'
ID 514047
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 044498-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R6344 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42574105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 36 (S36P)
Ref Sequence ENSEMBL: ENSMUSP00000123321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: S36P

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: S36P

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134707
AA Change: S36P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: S36P

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,327,706 (GRCm39) P707L probably damaging Het
Bbip1 A G 19: 53,919,912 (GRCm39) V23A probably benign Het
Bdnf A T 2: 109,554,022 (GRCm39) Y132F probably benign Het
C4bp T C 1: 130,583,752 (GRCm39) D72G probably benign Het
Cdcp1 T A 9: 123,011,447 (GRCm39) K343N possibly damaging Het
Cep112 A T 11: 108,410,000 (GRCm39) Y472F probably damaging Het
Cops2 A T 2: 125,700,899 (GRCm39) probably benign Het
Cyp27a1 T C 1: 74,776,008 (GRCm39) probably null Het
Dnah7a T C 1: 53,436,349 (GRCm39) I3998V probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Dnhd1 A G 7: 105,343,817 (GRCm39) I1720M probably benign Het
Fkbpl A G 17: 34,864,544 (GRCm39) K104R probably damaging Het
Helq G T 5: 100,914,594 (GRCm39) A966E probably benign Het
Iba57 G A 11: 59,049,119 (GRCm39) P350L probably damaging Het
Iqgap3 T C 3: 87,989,401 (GRCm39) probably null Het
Kcnj9 A G 1: 172,153,713 (GRCm39) V137A probably benign Het
Kif19a G A 11: 114,672,777 (GRCm39) probably null Het
Kmt2a A T 9: 44,733,156 (GRCm39) probably benign Het
Lilra5 T A 7: 4,241,785 (GRCm39) F195I probably damaging Het
Mcm9 A G 10: 53,414,033 (GRCm39) I349T probably benign Het
Mlst8 A G 17: 24,696,300 (GRCm39) L143P probably damaging Het
Mrc1 T C 2: 14,248,985 (GRCm39) F174L probably damaging Het
Muc5b T A 7: 141,416,708 (GRCm39) L3218Q possibly damaging Het
Myo1h A G 5: 114,466,776 (GRCm39) S275G probably damaging Het
Myo5a T A 9: 75,067,791 (GRCm39) V615D probably benign Het
Myo9b T C 8: 71,780,558 (GRCm39) L485P probably damaging Het
Nav1 A G 1: 135,378,534 (GRCm39) Y1646H probably damaging Het
Nsf A T 11: 103,752,730 (GRCm39) V539D probably damaging Het
Nutm1 A T 2: 112,079,247 (GRCm39) N889K possibly damaging Het
Or2n1b C T 17: 38,459,611 (GRCm39) A44V probably benign Het
Or55b3 A G 7: 102,126,738 (GRCm39) L113P probably damaging Het
Pcdhga2 T A 18: 37,803,815 (GRCm39) V553E probably benign Het
Pkmyt1 T C 17: 23,951,730 (GRCm39) S95P possibly damaging Het
Ranbp2 T A 10: 58,319,708 (GRCm39) probably null Het
Saxo2 T A 7: 82,284,073 (GRCm39) I262F probably damaging Het
Sco1 C T 11: 66,946,571 (GRCm39) R115W probably damaging Het
Slc27a3 G T 3: 90,294,961 (GRCm39) Y330* probably null Het
Slc6a4 C T 11: 76,909,080 (GRCm39) T364I probably damaging Het
Slit2 A G 5: 48,377,023 (GRCm39) I388V probably benign Het
Smc6 C A 12: 11,347,107 (GRCm39) probably benign Het
Snx25 C T 8: 46,488,675 (GRCm39) W747* probably null Het
Stard9 T A 2: 120,534,801 (GRCm39) M3686K probably benign Het
Syne1 T C 10: 4,972,212 (GRCm39) D8732G probably benign Het
Trpv6 T C 6: 41,602,356 (GRCm39) probably null Het
Tspear T C 10: 77,710,847 (GRCm39) F490L possibly damaging Het
Ttn A G 2: 76,552,196 (GRCm39) I31147T probably damaging Het
Ugt3a1 A C 15: 9,306,317 (GRCm39) E155D probably damaging Het
Urb2 G T 8: 124,757,864 (GRCm39) E1190D probably damaging Het
Washc2 G T 6: 116,235,719 (GRCm39) Q977H probably benign Het
Yars2 T A 16: 16,120,899 (GRCm39) W18R probably benign Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTAAGGAAGAATGCACCGC -3'
(R):5'- TCGTCGTGTAAGACTCTGTG -3'

Sequencing Primer
(F):5'- AATGCACCGCTATGGGAG -3'
(R):5'- CGTCGTGTAAGACTCTGTGAAAACAC -3'
Posted On 2018-04-27