Incidental Mutation 'R6344:Lilra5'
ID514049
Institutional Source Beutler Lab
Gene Symbol Lilra5
Ensembl Gene ENSMUSG00000070873
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
SynonymsGm4878
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6344 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4237754-4243463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4238786 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 195 (F195I)
Ref Sequence ENSEMBL: ENSMUSP00000113091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117550]
Predicted Effect probably damaging
Transcript: ENSMUST00000117550
AA Change: F195I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113091
Gene: ENSMUSG00000070873
AA Change: F195I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 34 118 4.67e-4 SMART
IG_like 129 217 5.13e0 SMART
transmembrane domain 250 267 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,437,694 P707L probably damaging Het
Bbip1 A G 19: 53,931,481 V23A probably benign Het
Bdnf A T 2: 109,723,677 Y132F probably benign Het
C4bp T C 1: 130,656,015 D72G probably benign Het
Cdcp1 T A 9: 123,182,382 K343N possibly damaging Het
Cep112 A T 11: 108,519,174 Y472F probably damaging Het
Cops2 A T 2: 125,858,979 probably benign Het
Cyp27a1 T C 1: 74,736,849 probably null Het
Dnah7a T C 1: 53,397,190 I3998V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Fkbpl A G 17: 34,645,570 K104R probably damaging Het
Helq G T 5: 100,766,728 A966E probably benign Het
Iba57 G A 11: 59,158,293 P350L probably damaging Het
Iqgap3 T C 3: 88,082,094 probably null Het
Kcnj9 A G 1: 172,326,146 V137A probably benign Het
Kif19a G A 11: 114,781,951 probably null Het
Kmt2a A T 9: 44,821,859 probably benign Het
Mcm9 A G 10: 53,537,937 I349T probably benign Het
Mlst8 A G 17: 24,477,326 L143P probably damaging Het
Mrc1 T C 2: 14,244,174 F174L probably damaging Het
Muc5b T A 7: 141,862,971 L3218Q possibly damaging Het
Myo1h A G 5: 114,328,715 S275G probably damaging Het
Myo5a T A 9: 75,160,509 V615D probably benign Het
Myo9b T C 8: 71,327,914 L485P probably damaging Het
Nav1 A G 1: 135,450,796 Y1646H probably damaging Het
Nsf A T 11: 103,861,904 V539D probably damaging Het
Nutm1 A T 2: 112,248,902 N889K possibly damaging Het
Olfr133 C T 17: 38,148,720 A44V probably benign Het
Olfr543 A G 7: 102,477,531 L113P probably damaging Het
Pcdhga2 T A 18: 37,670,762 V553E probably benign Het
Pkmyt1 T C 17: 23,732,756 S95P possibly damaging Het
Ranbp2 T A 10: 58,483,886 probably null Het
Saxo2 T A 7: 82,634,865 I262F probably damaging Het
Sco1 C T 11: 67,055,745 R115W probably damaging Het
Slc27a3 G T 3: 90,387,654 Y330* probably null Het
Slc6a4 C T 11: 77,018,254 T364I probably damaging Het
Slit2 A G 5: 48,219,681 I388V probably benign Het
Smc6 C A 12: 11,297,106 probably benign Het
Snx25 C T 8: 46,035,638 W747* probably null Het
Stard9 T A 2: 120,704,320 M3686K probably benign Het
Syne1 T C 10: 5,022,212 D8732G probably benign Het
Tcaf3 A G 6: 42,597,171 S36P possibly damaging Het
Trpv6 T C 6: 41,625,422 probably null Het
Tspear T C 10: 77,875,013 F490L possibly damaging Het
Ttn A G 2: 76,721,852 I31147T probably damaging Het
Ugt3a1 A C 15: 9,306,231 E155D probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Washc2 G T 6: 116,258,758 Q977H probably benign Het
Yars2 T A 16: 16,303,035 W18R probably benign Het
Other mutations in Lilra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Lilra5 APN 7 4237969 missense probably benign
IGL02281:Lilra5 APN 7 4238783 missense probably benign 0.00
R0458:Lilra5 UTSW 7 4238219 missense probably benign 0.26
R0611:Lilra5 UTSW 7 4242233 missense probably benign
R0685:Lilra5 UTSW 7 4241957 splice site probably benign
R3195:Lilra5 UTSW 7 4238757 missense probably damaging 0.96
R4726:Lilra5 UTSW 7 4237958 missense probably benign 0.00
R4745:Lilra5 UTSW 7 4242077 missense possibly damaging 0.72
R4836:Lilra5 UTSW 7 4238714 missense possibly damaging 0.71
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6263:Lilra5 UTSW 7 4238361 missense probably damaging 1.00
R6266:Lilra5 UTSW 7 4241928 missense possibly damaging 0.84
R6285:Lilra5 UTSW 7 4242115 missense probably damaging 1.00
R6292:Lilra5 UTSW 7 4238339 missense possibly damaging 0.81
R6861:Lilra5 UTSW 7 4241932 missense probably benign 0.14
R8353:Lilra5 UTSW 7 4237972 missense probably benign 0.06
R8681:Lilra5 UTSW 7 4238217 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATTCAGGGGAGACTGTAACCC -3'
(R):5'- GCCAGTACTCCTCCTAATCTGG -3'

Sequencing Primer
(F):5'- GGAGACTGTAACCCTTCAGTG -3'
(R):5'- GGGGCTCCAGTTCAGTTTCTC -3'
Posted On2018-04-27