Incidental Mutation 'R6344:Snx25'
ID514054
Institutional Source Beutler Lab
Gene Symbol Snx25
Ensembl Gene ENSMUSG00000038291
Gene Namesorting nexin 25
SynonymsLOC382008, SBBI31
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6344 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location46033261-46152159 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 46035638 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 747 (W747*)
Ref Sequence ENSEMBL: ENSMUSP00000127640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041582] [ENSMUST00000110378] [ENSMUST00000170416]
Predicted Effect probably null
Transcript: ENSMUST00000041582
AA Change: W747*
SMART Domains Protein: ENSMUSP00000035785
Gene: ENSMUSG00000038291
AA Change: W747*

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110378
AA Change: W893*
SMART Domains Protein: ENSMUSP00000106007
Gene: ENSMUSG00000038291
AA Change: W893*

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:PXA 145 306 8.7e-30 PFAM
RGS 433 547 6.62e-10 SMART
low complexity region 567 584 N/A INTRINSIC
PX 658 770 1.38e-10 SMART
low complexity region 804 809 N/A INTRINSIC
low complexity region 810 822 N/A INTRINSIC
Pfam:Nexin_C 847 953 1e-28 PFAM
low complexity region 958 974 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170416
AA Change: W747*
SMART Domains Protein: ENSMUSP00000127640
Gene: ENSMUSG00000038291
AA Change: W747*

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176410
Predicted Effect probably benign
Transcript: ENSMUST00000177186
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,437,694 P707L probably damaging Het
Bbip1 A G 19: 53,931,481 V23A probably benign Het
Bdnf A T 2: 109,723,677 Y132F probably benign Het
C4bp T C 1: 130,656,015 D72G probably benign Het
Cdcp1 T A 9: 123,182,382 K343N possibly damaging Het
Cep112 A T 11: 108,519,174 Y472F probably damaging Het
Cops2 A T 2: 125,858,979 probably benign Het
Cyp27a1 T C 1: 74,736,849 probably null Het
Dnah7a T C 1: 53,397,190 I3998V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Fkbpl A G 17: 34,645,570 K104R probably damaging Het
Helq G T 5: 100,766,728 A966E probably benign Het
Iba57 G A 11: 59,158,293 P350L probably damaging Het
Iqgap3 T C 3: 88,082,094 probably null Het
Kcnj9 A G 1: 172,326,146 V137A probably benign Het
Kif19a G A 11: 114,781,951 probably null Het
Kmt2a A T 9: 44,821,859 probably benign Het
Lilra5 T A 7: 4,238,786 F195I probably damaging Het
Mcm9 A G 10: 53,537,937 I349T probably benign Het
Mlst8 A G 17: 24,477,326 L143P probably damaging Het
Mrc1 T C 2: 14,244,174 F174L probably damaging Het
Muc5b T A 7: 141,862,971 L3218Q possibly damaging Het
Myo1h A G 5: 114,328,715 S275G probably damaging Het
Myo5a T A 9: 75,160,509 V615D probably benign Het
Myo9b T C 8: 71,327,914 L485P probably damaging Het
Nav1 A G 1: 135,450,796 Y1646H probably damaging Het
Nsf A T 11: 103,861,904 V539D probably damaging Het
Nutm1 A T 2: 112,248,902 N889K possibly damaging Het
Olfr133 C T 17: 38,148,720 A44V probably benign Het
Olfr543 A G 7: 102,477,531 L113P probably damaging Het
Pcdhga2 T A 18: 37,670,762 V553E probably benign Het
Pkmyt1 T C 17: 23,732,756 S95P possibly damaging Het
Ranbp2 T A 10: 58,483,886 probably null Het
Saxo2 T A 7: 82,634,865 I262F probably damaging Het
Sco1 C T 11: 67,055,745 R115W probably damaging Het
Slc27a3 G T 3: 90,387,654 Y330* probably null Het
Slc6a4 C T 11: 77,018,254 T364I probably damaging Het
Slit2 A G 5: 48,219,681 I388V probably benign Het
Smc6 C A 12: 11,297,106 probably benign Het
Stard9 T A 2: 120,704,320 M3686K probably benign Het
Syne1 T C 10: 5,022,212 D8732G probably benign Het
Tcaf3 A G 6: 42,597,171 S36P possibly damaging Het
Trpv6 T C 6: 41,625,422 probably null Het
Tspear T C 10: 77,875,013 F490L possibly damaging Het
Ttn A G 2: 76,721,852 I31147T probably damaging Het
Ugt3a1 A C 15: 9,306,231 E155D probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Washc2 G T 6: 116,258,758 Q977H probably benign Het
Yars2 T A 16: 16,303,035 W18R probably benign Het
Other mutations in Snx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Snx25 APN 8 46038476 missense probably damaging 1.00
IGL01432:Snx25 APN 8 46105160 missense probably damaging 0.96
IGL01600:Snx25 APN 8 46116310 missense probably benign 0.00
IGL02150:Snx25 APN 8 46116281 missense possibly damaging 0.89
IGL02386:Snx25 APN 8 46041349 missense possibly damaging 0.93
IGL02691:Snx25 APN 8 46105265 missense possibly damaging 0.88
IGL03338:Snx25 APN 8 46045210 missense probably benign 0.04
IGL03377:Snx25 APN 8 46080301 unclassified probably benign
duo UTSW 8 46124082 start codon destroyed probably null 0.88
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0056:Snx25 UTSW 8 46038513 missense probably damaging 1.00
R0546:Snx25 UTSW 8 46103630 missense probably benign 0.00
R0791:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1165:Snx25 UTSW 8 46035715 missense probably damaging 0.99
R1255:Snx25 UTSW 8 46116238 missense probably benign 0.13
R1262:Snx25 UTSW 8 46105291 missense probably damaging 0.98
R1522:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1652:Snx25 UTSW 8 46049473 missense probably damaging 0.99
R1710:Snx25 UTSW 8 46116207 missense possibly damaging 0.69
R1829:Snx25 UTSW 8 46035632 missense possibly damaging 0.82
R2090:Snx25 UTSW 8 46056113 missense probably damaging 1.00
R2158:Snx25 UTSW 8 46041407 missense probably damaging 1.00
R2906:Snx25 UTSW 8 46049523 intron probably null
R4244:Snx25 UTSW 8 46105254 missense probably damaging 0.98
R4394:Snx25 UTSW 8 46035678 missense probably damaging 1.00
R4465:Snx25 UTSW 8 46068229 missense possibly damaging 0.78
R4586:Snx25 UTSW 8 46116437 intron probably benign
R4663:Snx25 UTSW 8 46035579 missense probably damaging 1.00
R4961:Snx25 UTSW 8 46068192 missense probably damaging 0.99
R5104:Snx25 UTSW 8 46068166 makesense probably null
R5634:Snx25 UTSW 8 46041391 missense possibly damaging 0.94
R6128:Snx25 UTSW 8 46105203 missense probably benign 0.01
R6382:Snx25 UTSW 8 46055991 missense probably benign
R6523:Snx25 UTSW 8 46055855 missense probably damaging 0.96
R6798:Snx25 UTSW 8 46033773 missense probably damaging 0.98
R7143:Snx25 UTSW 8 46035715 missense possibly damaging 0.92
R7147:Snx25 UTSW 8 46105196 missense probably damaging 0.98
R7519:Snx25 UTSW 8 46116272 missense probably damaging 1.00
R7723:Snx25 UTSW 8 46038479 missense probably damaging 1.00
RF002:Snx25 UTSW 8 46116181 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCATGCACACTCTCAGGC -3'
(R):5'- GTATCCTAACCCAGCCATTGAC -3'

Sequencing Primer
(F):5'- TGTCGGTGCACACTCTCAGAC -3'
(R):5'- GCCATTGACAAATGCCTTCTGAG -3'
Posted On2018-04-27