Incidental Mutation 'R6344:Ugt3a1'
ID514071
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene NameUDP glycosyltransferases 3 family, polypeptide A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6344 (G1)
Quality Score157.009
Status Not validated
Chromosome15
Chromosomal Location9276888-9315032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 9306231 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 155 (E155D)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
Predicted Effect probably damaging
Transcript: ENSMUST00000022861
AA Change: E155D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: E155D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176173
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,437,694 P707L probably damaging Het
Bbip1 A G 19: 53,931,481 V23A probably benign Het
Bdnf A T 2: 109,723,677 Y132F probably benign Het
C4bp T C 1: 130,656,015 D72G probably benign Het
Cdcp1 T A 9: 123,182,382 K343N possibly damaging Het
Cep112 A T 11: 108,519,174 Y472F probably damaging Het
Cops2 A T 2: 125,858,979 probably benign Het
Cyp27a1 T C 1: 74,736,849 probably null Het
Dnah7a T C 1: 53,397,190 I3998V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Fkbpl A G 17: 34,645,570 K104R probably damaging Het
Helq G T 5: 100,766,728 A966E probably benign Het
Iba57 G A 11: 59,158,293 P350L probably damaging Het
Iqgap3 T C 3: 88,082,094 probably null Het
Kcnj9 A G 1: 172,326,146 V137A probably benign Het
Kif19a G A 11: 114,781,951 probably null Het
Kmt2a A T 9: 44,821,859 probably benign Het
Lilra5 T A 7: 4,238,786 F195I probably damaging Het
Mcm9 A G 10: 53,537,937 I349T probably benign Het
Mlst8 A G 17: 24,477,326 L143P probably damaging Het
Mrc1 T C 2: 14,244,174 F174L probably damaging Het
Muc5b T A 7: 141,862,971 L3218Q possibly damaging Het
Myo1h A G 5: 114,328,715 S275G probably damaging Het
Myo5a T A 9: 75,160,509 V615D probably benign Het
Myo9b T C 8: 71,327,914 L485P probably damaging Het
Nav1 A G 1: 135,450,796 Y1646H probably damaging Het
Nsf A T 11: 103,861,904 V539D probably damaging Het
Nutm1 A T 2: 112,248,902 N889K possibly damaging Het
Olfr133 C T 17: 38,148,720 A44V probably benign Het
Olfr543 A G 7: 102,477,531 L113P probably damaging Het
Pcdhga2 T A 18: 37,670,762 V553E probably benign Het
Pkmyt1 T C 17: 23,732,756 S95P possibly damaging Het
Ranbp2 T A 10: 58,483,886 probably null Het
Saxo2 T A 7: 82,634,865 I262F probably damaging Het
Sco1 C T 11: 67,055,745 R115W probably damaging Het
Slc27a3 G T 3: 90,387,654 Y330* probably null Het
Slc6a4 C T 11: 77,018,254 T364I probably damaging Het
Slit2 A G 5: 48,219,681 I388V probably benign Het
Smc6 C A 12: 11,297,106 probably benign Het
Snx25 C T 8: 46,035,638 W747* probably null Het
Stard9 T A 2: 120,704,320 M3686K probably benign Het
Syne1 T C 10: 5,022,212 D8732G probably benign Het
Tcaf3 A G 6: 42,597,171 S36P possibly damaging Het
Trpv6 T C 6: 41,625,422 probably null Het
Tspear T C 10: 77,875,013 F490L possibly damaging Het
Ttn A G 2: 76,721,852 I31147T probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Washc2 G T 6: 116,258,758 Q977H probably benign Het
Yars2 T A 16: 16,303,035 W18R probably benign Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
R8414:Ugt3a1 UTSW 15 9310583 missense possibly damaging 0.82
R8981:Ugt3a1 UTSW 15 9311928 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCATAACATCATTCCAAATAGTGTG -3'
(R):5'- GCTTCTTGGTGAAATGAAAGAACATC -3'

Sequencing Primer
(F):5'- TCCAAATAGTGTGAAAAAGCTTCTC -3'
(R):5'- ACATCAGAATGTTCTTCACTCGG -3'
Posted On2018-04-27