Incidental Mutation 'R6344:Yars2'
ID514072
Institutional Source Beutler Lab
Gene Symbol Yars2
Ensembl Gene ENSMUSG00000022792
Gene Nametyrosyl-tRNA synthetase 2 (mitochondrial)
Synonyms2210023C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6344 (G1)
Quality Score140.008
Status Not validated
Chromosome16
Chromosomal Location16302965-16309640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16303035 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 18 (W18R)
Ref Sequence ENSEMBL: ENSMUSP00000125252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059955] [ENSMUST00000159683] [ENSMUST00000159962] [ENSMUST00000162734]
Predicted Effect probably benign
Transcript: ENSMUST00000059955
AA Change: W18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055277
Gene: ENSMUSG00000022792
AA Change: W18R

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 370 5.9e-74 PFAM
Blast:S4 403 466 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159583
Predicted Effect probably benign
Transcript: ENSMUST00000159683
AA Change: W18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124606
Gene: ENSMUSG00000022792
AA Change: W18R

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159962
AA Change: W18R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125252
Gene: ENSMUSG00000022792
AA Change: W18R

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161191
Predicted Effect probably benign
Transcript: ENSMUST00000162734
SMART Domains Protein: ENSMUSP00000125496
Gene: ENSMUSG00000022792

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 102 7.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that catalyzes the attachment of tyrosine to tRNA(Tyr). Mutations in this gene are associated with myopathy with lactic acidosis and sideroblastic anemia type 2 (MLASA2). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,437,694 P707L probably damaging Het
Bbip1 A G 19: 53,931,481 V23A probably benign Het
Bdnf A T 2: 109,723,677 Y132F probably benign Het
C4bp T C 1: 130,656,015 D72G probably benign Het
Cdcp1 T A 9: 123,182,382 K343N possibly damaging Het
Cep112 A T 11: 108,519,174 Y472F probably damaging Het
Cops2 A T 2: 125,858,979 probably benign Het
Cyp27a1 T C 1: 74,736,849 probably null Het
Dnah7a T C 1: 53,397,190 I3998V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Fkbpl A G 17: 34,645,570 K104R probably damaging Het
Helq G T 5: 100,766,728 A966E probably benign Het
Iba57 G A 11: 59,158,293 P350L probably damaging Het
Iqgap3 T C 3: 88,082,094 probably null Het
Kcnj9 A G 1: 172,326,146 V137A probably benign Het
Kif19a G A 11: 114,781,951 probably null Het
Kmt2a A T 9: 44,821,859 probably benign Het
Lilra5 T A 7: 4,238,786 F195I probably damaging Het
Mcm9 A G 10: 53,537,937 I349T probably benign Het
Mlst8 A G 17: 24,477,326 L143P probably damaging Het
Mrc1 T C 2: 14,244,174 F174L probably damaging Het
Muc5b T A 7: 141,862,971 L3218Q possibly damaging Het
Myo1h A G 5: 114,328,715 S275G probably damaging Het
Myo5a T A 9: 75,160,509 V615D probably benign Het
Myo9b T C 8: 71,327,914 L485P probably damaging Het
Nav1 A G 1: 135,450,796 Y1646H probably damaging Het
Nsf A T 11: 103,861,904 V539D probably damaging Het
Nutm1 A T 2: 112,248,902 N889K possibly damaging Het
Olfr133 C T 17: 38,148,720 A44V probably benign Het
Olfr543 A G 7: 102,477,531 L113P probably damaging Het
Pcdhga2 T A 18: 37,670,762 V553E probably benign Het
Pkmyt1 T C 17: 23,732,756 S95P possibly damaging Het
Ranbp2 T A 10: 58,483,886 probably null Het
Saxo2 T A 7: 82,634,865 I262F probably damaging Het
Sco1 C T 11: 67,055,745 R115W probably damaging Het
Slc27a3 G T 3: 90,387,654 Y330* probably null Het
Slc6a4 C T 11: 77,018,254 T364I probably damaging Het
Slit2 A G 5: 48,219,681 I388V probably benign Het
Smc6 C A 12: 11,297,106 probably benign Het
Snx25 C T 8: 46,035,638 W747* probably null Het
Stard9 T A 2: 120,704,320 M3686K probably benign Het
Syne1 T C 10: 5,022,212 D8732G probably benign Het
Tcaf3 A G 6: 42,597,171 S36P possibly damaging Het
Trpv6 T C 6: 41,625,422 probably null Het
Tspear T C 10: 77,875,013 F490L possibly damaging Het
Ttn A G 2: 76,721,852 I31147T probably damaging Het
Ugt3a1 A C 15: 9,306,231 E155D probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Washc2 G T 6: 116,258,758 Q977H probably benign Het
Other mutations in Yars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Yars2 APN 16 16303321 missense probably damaging 0.99
IGL01061:Yars2 APN 16 16306542 nonsense probably null
IGL01062:Yars2 APN 16 16306542 nonsense probably null
IGL01063:Yars2 APN 16 16306542 nonsense probably null
IGL01066:Yars2 APN 16 16306542 nonsense probably null
IGL01069:Yars2 APN 16 16306542 nonsense probably null
IGL01070:Yars2 APN 16 16306542 nonsense probably null
IGL02928:Yars2 APN 16 16303546 missense probably damaging 1.00
R4718:Yars2 UTSW 16 16309340 missense probably benign 0.00
R5012:Yars2 UTSW 16 16303584 missense probably damaging 0.98
R5498:Yars2 UTSW 16 16306523 missense possibly damaging 0.62
R5585:Yars2 UTSW 16 16304620 missense probably damaging 1.00
R5935:Yars2 UTSW 16 16309471 missense probably benign 0.02
R6302:Yars2 UTSW 16 16304574 missense probably damaging 1.00
R7218:Yars2 UTSW 16 16303318 missense probably damaging 1.00
R7235:Yars2 UTSW 16 16304692 missense probably benign
R7921:Yars2 UTSW 16 16304521 splice site probably null
X0062:Yars2 UTSW 16 16303018 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CATTCCAGGACTGCCTACAG -3'
(R):5'- CAACAGAGTTAGCAGGTGCC -3'

Sequencing Primer
(F):5'- TACAGCACCAAAGCCTAACAGG -3'
(R):5'- AGTTAGCAGGTGCCCCACG -3'
Posted On2018-04-27