Mutagenetix > Incidental Mutations

Incidental Mutation 'R6345:Rb1cc1'

514080

Institutional Source

Beutler Lab

Gene Symbol

Rb1cc1

Ensembl Gene

ENSMUSG00000025907

Gene Name

RB1-inducible coiled-coil 1

Synonyms

Cc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6206197-6276648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 6263257 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1440 (S1440T)

Ref Sequence

ENSEMBL: ENSMUSP00000027040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000159530]

Predicted Effect

probably benign
Transcript: ENSMUST00000027040
AA Change: S1440T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: S1440T

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	7e-4	SMART
Blast:UBQ	3	76	8e-12	BLAST
low complexity region	471	486	N/A	INTRINSIC
low complexity region	643	653	N/A	INTRINSIC
low complexity region	658	674	N/A	INTRINSIC
coiled coil region	859	921	N/A	INTRINSIC
low complexity region	1033	1045	N/A	INTRINSIC
low complexity region	1055	1066	N/A	INTRINSIC
SCOP:d1eq1a_	1159	1305	1e-3	SMART
low complexity region	1374	1388	N/A	INTRINSIC
Pfam:ATG11	1447	1583	5.6e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159349

Predicted Effect

probably benign
Transcript: ENSMUST00000159530
AA Change: S82T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124220
Gene: ENSMUSG00000025907
AA Change: S82T

Domain	Start	End	E-Value	Type
coiled coil region	1	35	N/A	INTRINSIC
Pfam:ATG11	84	223	1.8e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159661

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161183

Predicted Effect

unknown
Transcript: ENSMUST00000161327
AA Change: S1319T

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: S1319T

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000162257
AA Change: S530T

SMART Domains

Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907
AA Change: S530T

Domain	Start	End	E-Value	Type
coiled coil region	33	331	N/A	INTRINSIC
low complexity region	335	355	N/A	INTRINSIC
coiled coil region	363	483	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162418

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,226,051	I121T	probably benign	Het
4921524L21Rik	T	A	18: 6,626,399	M137K	possibly damaging	Het
Angpt4	C	A	2: 151,929,434	N223K	probably benign	Het
Ankrd6	T	C	4: 32,810,266	R437G	probably damaging	Het
Atp9a	C	T	2: 168,676,173	S264N	probably damaging	Het
AY358078	A	C	14: 51,826,292	Y465S	probably damaging	Het
Bin3	G	A	14: 70,137,227	R235Q	probably benign	Het
Bsn	G	A	9: 108,107,355	P3167S	unknown	Het
Camk2g	G	A	14: 20,737,375	R274C	probably damaging	Het
Ccdc61	A	T	7: 18,909,989		probably null	Het
Ccnjl	A	T	11: 43,585,338	T263S	probably benign	Het
Col17a1	G	T	19: 47,653,379	P944T	possibly damaging	Het
Cyp2c39	A	T	19: 39,513,171		probably null	Het
Cyp2c39	G	T	19: 39,513,172		probably null	Het
Cyp4a32	T	C	4: 115,602,363	V98A	possibly damaging	Het
D430042O09Rik	C	A	7: 125,752,987	D26E	probably damaging	Het
Dnah9	A	G	11: 66,037,693	V2050A	probably damaging	Het
F5	A	G	1: 164,191,951	N665S	probably benign	Het
Fbxl6	A	T	15: 76,535,854	C520S	probably damaging	Het
Fscn2	C	A	11: 120,362,027	H107N	probably damaging	Het
Gfm2	C	T	13: 97,162,953	T367M	probably damaging	Het
Gle1	C	G	2: 29,936,115	P69A	probably benign	Het
Gpr156	A	T	16: 37,987,519	D176V	probably damaging	Het
Grip2	A	G	6: 91,765,388	S895P	possibly damaging	Het
Hfm1	C	T	5: 106,841,638	G1404D	probably benign	Het
Ifit1bl1	G	A	19: 34,594,170	R296*	probably null	Het
Ighv1-39	C	T	12: 114,914,859	V31M	possibly damaging	Het
Itgav	A	G	2: 83,802,036	E956G	probably damaging	Het
Lsm8	A	G	6: 18,853,645	D86G	probably damaging	Het
Mdh1b	T	G	1: 63,715,239	H390P	possibly damaging	Het
Mtrf1l	A	T	10: 5,817,468	I216N	possibly damaging	Het
Muc16	G	A	9: 18,654,926	T2099I	unknown	Het
Myh7	T	C	14: 54,983,692	R925G	probably damaging	Het
Myo1h	T	A	5: 114,351,708	I658N	probably damaging	Het
Myo5a	A	T	9: 75,189,913	D81V	possibly damaging	Het
Nell1	G	A	7: 49,975,423	C12Y	possibly damaging	Het
Obscn	T	C	11: 59,053,696	Y4724C	probably damaging	Het
Olfr1055	A	G	2: 86,347,548	Y73H	probably damaging	Het
Pah	G	A	10: 87,576,187	D315N	probably damaging	Het
Per2	A	G	1: 91,448,722	V143A	probably damaging	Het
Plcxd1	T	C	5: 110,100,299	V38A	probably benign	Het
Pld1	A	G	3: 28,130,747		probably benign	Het
Plekhh2	A	G	17: 84,575,787	N761S	probably benign	Het
Polh	T	C	17: 46,182,738	I318V	probably benign	Het
Prex1	T	C	2: 166,572,960	Q1323R	probably null	Het
Rbm19	G	T	5: 120,127,040	W382L	possibly damaging	Het
Rchy1	T	C	5: 91,957,942	D49G	probably benign	Het
Ric1	A	G	19: 29,604,085	D1402G	probably benign	Het
S1pr3	G	T	13: 51,419,031	A83S	probably damaging	Het
S1pr3	C	A	13: 51,419,032	A83D	probably damaging	Het
Selplg	G	A	5: 113,820,149	P32L	probably benign	Het
Serpinb9c	T	C	13: 33,149,995	R355G	probably damaging	Het
Slx4	G	C	16: 3,990,850	Q409E	probably benign	Het
Sntg1	A	C	1: 8,583,284	L243R	possibly damaging	Het
Specc1l	G	T	10: 75,248,488	D682Y	probably damaging	Het
Spen	C	T	4: 141,471,633	V3228I	possibly damaging	Het
Strip1	T	C	3: 107,628,200	E69G	probably damaging	Het
Tasp1	C	A	2: 139,951,537	V240L	probably damaging	Het
Tdrd9	T	A	12: 112,034,608	F787L	probably damaging	Het
Vmn1r228	A	G	17: 20,776,882	S125P	probably damaging	Het
Wdhd1	A	G	14: 47,251,922	M718T	probably damaging	Het

Other mutations in Rb1cc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Rb1cc1	APN	1	6249506	missense	probably damaging	0.97
IGL00590:Rb1cc1	APN	1	6238296	missense	probably damaging	1.00
IGL00678:Rb1cc1	APN	1	6234085	missense	probably damaging	1.00
IGL00705:Rb1cc1	APN	1	6244133	missense	probably benign	0.00
IGL00957:Rb1cc1	APN	1	6249539	missense	probably damaging	1.00
IGL01363:Rb1cc1	APN	1	6250109	missense	probably benign	0.06
IGL01599:Rb1cc1	APN	1	6248771	nonsense	probably null
IGL01610:Rb1cc1	APN	1	6248481	missense	probably benign	0.03
IGL01929:Rb1cc1	APN	1	6240159	missense	possibly damaging	0.82
IGL01978:Rb1cc1	APN	1	6238368	missense	probably damaging	1.00
IGL02312:Rb1cc1	APN	1	6265623	critical splice donor site	probably null
IGL02471:Rb1cc1	APN	1	6240051	missense	probably benign	0.01
IGL02677:Rb1cc1	APN	1	6249419	missense	probably benign
IGL02702:Rb1cc1	APN	1	6240023	missense	probably damaging	0.99
IGL02816:Rb1cc1	APN	1	6262828	splice site	probably benign
IGL02899:Rb1cc1	APN	1	6264583	missense	probably damaging	1.00
fingerling	UTSW	1	6261032	missense	probably damaging	1.00
tots	UTSW	1	6245637	missense	probably damaging	0.99
IGL02988:Rb1cc1	UTSW	1	6247811	critical splice donor site	probably null
R0020:Rb1cc1	UTSW	1	6264548	missense	possibly damaging	0.86
R0254:Rb1cc1	UTSW	1	6262847	missense	probably damaging	1.00
R0390:Rb1cc1	UTSW	1	6248634	missense	probably damaging	1.00
R0466:Rb1cc1	UTSW	1	6263267	splice site	probably null
R0482:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R0510:Rb1cc1	UTSW	1	6249171	missense	probably benign	0.00
R0512:Rb1cc1	UTSW	1	6248543	missense	probably damaging	1.00
R0616:Rb1cc1	UTSW	1	6244262	missense	possibly damaging	0.80
R0617:Rb1cc1	UTSW	1	6248790	missense	possibly damaging	0.83
R0837:Rb1cc1	UTSW	1	6234271	unclassified	probably null
R1399:Rb1cc1	UTSW	1	6249818	missense	probably benign	0.00
R1532:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R1542:Rb1cc1	UTSW	1	6244249	missense	possibly damaging	0.82
R1746:Rb1cc1	UTSW	1	6263013	splice site	probably null
R1764:Rb1cc1	UTSW	1	6214680	intron	probably benign
R1968:Rb1cc1	UTSW	1	6248195	splice site	probably null
R2025:Rb1cc1	UTSW	1	6245309	missense	probably damaging	1.00
R2076:Rb1cc1	UTSW	1	6250038	missense	possibly damaging	0.82
R2101:Rb1cc1	UTSW	1	6249335	missense	probably benign
R2249:Rb1cc1	UTSW	1	6272724	missense	probably damaging	1.00
R3176:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3276:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3716:Rb1cc1	UTSW	1	6270690	critical splice acceptor site	probably null
R3747:Rb1cc1	UTSW	1	6248742	missense	possibly damaging	0.92
R3850:Rb1cc1	UTSW	1	6250113	missense	probably benign	0.22
R3967:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3969:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3972:Rb1cc1	UTSW	1	6249000	missense	probably benign	0.00
R4166:Rb1cc1	UTSW	1	6265663	intron	probably benign
R4168:Rb1cc1	UTSW	1	6230024	missense	probably damaging	1.00
R4358:Rb1cc1	UTSW	1	6245637	missense	probably damaging	0.99
R4370:Rb1cc1	UTSW	1	6248547	missense	probably damaging	1.00
R4869:Rb1cc1	UTSW	1	6215021	intron	probably benign
R4945:Rb1cc1	UTSW	1	6249627	missense	probably benign	0.24
R5111:Rb1cc1	UTSW	1	6214634	intron	probably benign
R5175:Rb1cc1	UTSW	1	6248321	missense	probably benign
R5196:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R5271:Rb1cc1	UTSW	1	6249193	nonsense	probably null
R5341:Rb1cc1	UTSW	1	6215042	intron	probably benign
R5952:Rb1cc1	UTSW	1	6248182	missense	probably benign
R5992:Rb1cc1	UTSW	1	6233996	missense	probably damaging	1.00
R6054:Rb1cc1	UTSW	1	6249834	missense	probably benign	0.01
R6064:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R6313:Rb1cc1	UTSW	1	6244133	missense	probably benign	0.00
R6488:Rb1cc1	UTSW	1	6270727	missense	probably damaging	0.97
R6566:Rb1cc1	UTSW	1	6249092	missense	probably benign	0.15
R6739:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R6829:Rb1cc1	UTSW	1	6249264	missense	probably benign	0.04
R6945:Rb1cc1	UTSW	1	6261032	missense	probably damaging	1.00
R6976:Rb1cc1	UTSW	1	6262902	missense	probably benign	0.01
R7031:Rb1cc1	UTSW	1	6238466	critical splice donor site	probably null
R7066:Rb1cc1	UTSW	1	6250005	missense	possibly damaging	0.69
R7185:Rb1cc1	UTSW	1	6238383	missense	probably damaging	1.00
R7276:Rb1cc1	UTSW	1	6249192	missense	probably benign	0.13
R7448:Rb1cc1	UTSW	1	6245503	missense	probably damaging	1.00
R7463:Rb1cc1	UTSW	1	6249180	missense	probably benign
R7484:Rb1cc1	UTSW	1	6274217	missense	probably damaging	1.00
R7496:Rb1cc1	UTSW	1	6248191	missense	probably null	0.02
R7681:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
Z1088:Rb1cc1	UTSW	1	6249018	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGGAAGTGAGTAAACTCCGC -3'
(R):5'- AGAGGTCACTTTCCACTCTGG -3'

Sequencing Primer
(F):5'- GAGTAAACTCCGCACTAGCAGTTTTC -3'
(R):5'- GTGTCAAGCACTGCTGAA -3'

Posted On

2018-04-27