Mutagenetix > Incidental Mutations

Incidental Mutation 'R6345:Itgav'

514086

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83802036 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 956 (E956G)

Ref Sequence

ENSEMBL: ENSMUSP00000028499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028499
AA Change: E956G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: E956G

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111740
AA Change: E920G

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: E920G

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000125402
AA Change: E31G

SMART Domains

Protein: ENSMUSP00000118016
Gene: ENSMUSG00000027087
AA Change: E31G

Domain	Start	End	E-Value	Type
SCOP:d1m1xa3	2	58	7e-19	SMART
PDB:3IJE\|A	2	69	3e-41	PDB
low complexity region	71	84	N/A	INTRINSIC
Pfam:Integrin_alpha	89	103	1.4e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131192

SMART Domains

Protein: ENSMUSP00000121295
Gene: ENSMUSG00000027087

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Integrin_alpha	28	42	4.5e-9	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,226,051	I121T	probably benign	Het
4921524L21Rik	T	A	18: 6,626,399	M137K	possibly damaging	Het
Angpt4	C	A	2: 151,929,434	N223K	probably benign	Het
Ankrd6	T	C	4: 32,810,266	R437G	probably damaging	Het
Atp9a	C	T	2: 168,676,173	S264N	probably damaging	Het
AY358078	A	C	14: 51,826,292	Y465S	probably damaging	Het
Bin3	G	A	14: 70,137,227	R235Q	probably benign	Het
Bsn	G	A	9: 108,107,355	P3167S	unknown	Het
Camk2g	G	A	14: 20,737,375	R274C	probably damaging	Het
Ccdc61	A	T	7: 18,909,989		probably null	Het
Ccnjl	A	T	11: 43,585,338	T263S	probably benign	Het
Col17a1	G	T	19: 47,653,379	P944T	possibly damaging	Het
Cyp2c39	A	T	19: 39,513,171		probably null	Het
Cyp2c39	G	T	19: 39,513,172		probably null	Het
Cyp4a32	T	C	4: 115,602,363	V98A	possibly damaging	Het
D430042O09Rik	C	A	7: 125,752,987	D26E	probably damaging	Het
Dnah9	A	G	11: 66,037,693	V2050A	probably damaging	Het
F5	A	G	1: 164,191,951	N665S	probably benign	Het
Fbxl6	A	T	15: 76,535,854	C520S	probably damaging	Het
Fscn2	C	A	11: 120,362,027	H107N	probably damaging	Het
Gfm2	C	T	13: 97,162,953	T367M	probably damaging	Het
Gle1	C	G	2: 29,936,115	P69A	probably benign	Het
Gpr156	A	T	16: 37,987,519	D176V	probably damaging	Het
Grip2	A	G	6: 91,765,388	S895P	possibly damaging	Het
Hfm1	C	T	5: 106,841,638	G1404D	probably benign	Het
Ifit1bl1	G	A	19: 34,594,170	R296*	probably null	Het
Ighv1-39	C	T	12: 114,914,859	V31M	possibly damaging	Het
Lsm8	A	G	6: 18,853,645	D86G	probably damaging	Het
Mdh1b	T	G	1: 63,715,239	H390P	possibly damaging	Het
Mtrf1l	A	T	10: 5,817,468	I216N	possibly damaging	Het
Muc16	G	A	9: 18,654,926	T2099I	unknown	Het
Myh7	T	C	14: 54,983,692	R925G	probably damaging	Het
Myo1h	T	A	5: 114,351,708	I658N	probably damaging	Het
Myo5a	A	T	9: 75,189,913	D81V	possibly damaging	Het
Nell1	G	A	7: 49,975,423	C12Y	possibly damaging	Het
Obscn	T	C	11: 59,053,696	Y4724C	probably damaging	Het
Olfr1055	A	G	2: 86,347,548	Y73H	probably damaging	Het
Pah	G	A	10: 87,576,187	D315N	probably damaging	Het
Per2	A	G	1: 91,448,722	V143A	probably damaging	Het
Plcxd1	T	C	5: 110,100,299	V38A	probably benign	Het
Pld1	A	G	3: 28,130,747		probably benign	Het
Plekhh2	A	G	17: 84,575,787	N761S	probably benign	Het
Polh	T	C	17: 46,182,738	I318V	probably benign	Het
Prex1	T	C	2: 166,572,960	Q1323R	probably null	Het
Rb1cc1	T	A	1: 6,263,257	S1440T	probably benign	Het
Rbm19	G	T	5: 120,127,040	W382L	possibly damaging	Het
Rchy1	T	C	5: 91,957,942	D49G	probably benign	Het
Ric1	A	G	19: 29,604,085	D1402G	probably benign	Het
S1pr3	G	T	13: 51,419,031	A83S	probably damaging	Het
S1pr3	C	A	13: 51,419,032	A83D	probably damaging	Het
Selplg	G	A	5: 113,820,149	P32L	probably benign	Het
Serpinb9c	T	C	13: 33,149,995	R355G	probably damaging	Het
Slx4	G	C	16: 3,990,850	Q409E	probably benign	Het
Sntg1	A	C	1: 8,583,284	L243R	possibly damaging	Het
Specc1l	G	T	10: 75,248,488	D682Y	probably damaging	Het
Spen	C	T	4: 141,471,633	V3228I	possibly damaging	Het
Strip1	T	C	3: 107,628,200	E69G	probably damaging	Het
Tasp1	C	A	2: 139,951,537	V240L	probably damaging	Het
Tdrd9	T	A	12: 112,034,608	F787L	probably damaging	Het
Vmn1r228	A	G	17: 20,776,882	S125P	probably damaging	Het
Wdhd1	A	G	14: 47,251,922	M718T	probably damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2176:Itgav	UTSW	2	83803255	missense	probably damaging	1.00
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGTGGACCGAGACGTTCATG -3'
(R):5'- GGGCCAGCTCTACTAATTCTAGG -3'

Sequencing Primer
(F):5'- TTCATGAACGTAAGCAGACAGAC -3'
(R):5'- TGCACACTGTGATACGTGAC -3'

Posted On

2018-04-27