Incidental Mutation 'R6345:Prex1'
ID 514090
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Name phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms P-REX1
MMRRC Submission 044499-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R6345 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 166408265-166555752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 166414880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 1323 (Q1323R)
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]
AlphaFold Q69ZK0
Predicted Effect probably null
Transcript: ENSMUST00000036719
AA Change: Q1493R

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: Q1493R

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099080
AA Change: Q1323R

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: Q1323R

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109246
AA Change: Q305R

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621
AA Change: Q305R

DomainStartEndE-ValueType
low complexity region 357 367 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136974
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,061,913 (GRCm39) I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 (GRCm39) M137K possibly damaging Het
Angpt4 C A 2: 151,771,354 (GRCm39) N223K probably benign Het
Ankrd6 T C 4: 32,810,266 (GRCm39) R437G probably damaging Het
Atp9a C T 2: 168,518,093 (GRCm39) S264N probably damaging Het
AY358078 A C 14: 52,063,749 (GRCm39) Y465S probably damaging Het
Bin3 G A 14: 70,374,676 (GRCm39) R235Q probably benign Het
Bsn G A 9: 107,984,554 (GRCm39) P3167S unknown Het
Camk2g G A 14: 20,787,443 (GRCm39) R274C probably damaging Het
Ccdc61 A T 7: 18,643,914 (GRCm39) probably null Het
Ccnjl A T 11: 43,476,165 (GRCm39) T263S probably benign Het
Col17a1 G T 19: 47,641,818 (GRCm39) P944T possibly damaging Het
Cyp2c39 A T 19: 39,501,615 (GRCm39) probably null Het
Cyp2c39 G T 19: 39,501,616 (GRCm39) probably null Het
Cyp4a32 T C 4: 115,459,560 (GRCm39) V98A possibly damaging Het
Dnah9 A G 11: 65,928,519 (GRCm39) V2050A probably damaging Het
F5 A G 1: 164,019,520 (GRCm39) N665S probably benign Het
Fbxl6 A T 15: 76,420,054 (GRCm39) C520S probably damaging Het
Fscn2 C A 11: 120,252,853 (GRCm39) H107N probably damaging Het
Gfm2 C T 13: 97,299,461 (GRCm39) T367M probably damaging Het
Gle1 C G 2: 29,826,127 (GRCm39) P69A probably benign Het
Gpr156 A T 16: 37,807,881 (GRCm39) D176V probably damaging Het
Grip2 A G 6: 91,742,369 (GRCm39) S895P possibly damaging Het
Hfm1 C T 5: 106,989,504 (GRCm39) G1404D probably benign Het
Ifit1bl1 G A 19: 34,571,570 (GRCm39) R296* probably null Het
Ighv1-39 C T 12: 114,878,479 (GRCm39) V31M possibly damaging Het
Itgav A G 2: 83,632,380 (GRCm39) E956G probably damaging Het
Katnip C A 7: 125,352,159 (GRCm39) D26E probably damaging Het
Lsm8 A G 6: 18,853,644 (GRCm39) D86G probably damaging Het
Mdh1b T G 1: 63,754,398 (GRCm39) H390P possibly damaging Het
Mtrf1l A T 10: 5,767,468 (GRCm39) I216N possibly damaging Het
Muc16 G A 9: 18,566,222 (GRCm39) T2099I unknown Het
Myh7 T C 14: 55,221,149 (GRCm39) R925G probably damaging Het
Myo1h T A 5: 114,489,769 (GRCm39) I658N probably damaging Het
Myo5a A T 9: 75,097,195 (GRCm39) D81V possibly damaging Het
Nell1 G A 7: 49,625,171 (GRCm39) C12Y possibly damaging Het
Obscn T C 11: 58,944,522 (GRCm39) Y4724C probably damaging Het
Or8k53 A G 2: 86,177,892 (GRCm39) Y73H probably damaging Het
Pah G A 10: 87,412,049 (GRCm39) D315N probably damaging Het
Per2 A G 1: 91,376,444 (GRCm39) V143A probably damaging Het
Plcxd1 T C 5: 110,248,165 (GRCm39) V38A probably benign Het
Pld1 A G 3: 28,184,896 (GRCm39) probably benign Het
Plekhh2 A G 17: 84,883,215 (GRCm39) N761S probably benign Het
Polh T C 17: 46,493,664 (GRCm39) I318V probably benign Het
Rb1cc1 T A 1: 6,333,481 (GRCm39) S1440T probably benign Het
Rbm19 G T 5: 120,265,105 (GRCm39) W382L possibly damaging Het
Rchy1 T C 5: 92,105,801 (GRCm39) D49G probably benign Het
Ric1 A G 19: 29,581,485 (GRCm39) D1402G probably benign Het
S1pr3 G T 13: 51,573,067 (GRCm39) A83S probably damaging Het
S1pr3 C A 13: 51,573,068 (GRCm39) A83D probably damaging Het
Selplg G A 5: 113,958,210 (GRCm39) P32L probably benign Het
Serpinb9c T C 13: 33,333,978 (GRCm39) R355G probably damaging Het
Slx4 G C 16: 3,808,714 (GRCm39) Q409E probably benign Het
Sntg1 A C 1: 8,653,508 (GRCm39) L243R possibly damaging Het
Specc1l G T 10: 75,084,322 (GRCm39) D682Y probably damaging Het
Spen C T 4: 141,198,944 (GRCm39) V3228I possibly damaging Het
Strip1 T C 3: 107,535,516 (GRCm39) E69G probably damaging Het
Tasp1 C A 2: 139,793,457 (GRCm39) V240L probably damaging Het
Tdrd9 T A 12: 112,001,042 (GRCm39) F787L probably damaging Het
Vmn1r228 A G 17: 20,997,144 (GRCm39) S125P probably damaging Het
Wdhd1 A G 14: 47,489,379 (GRCm39) M718T probably damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166,480,321 (GRCm39) missense probably damaging 1.00
IGL00309:Prex1 APN 2 166,451,743 (GRCm39) missense probably damaging 0.99
IGL00953:Prex1 APN 2 166,480,329 (GRCm39) missense probably damaging 1.00
IGL00961:Prex1 APN 2 166,427,656 (GRCm39) missense probably damaging 0.98
IGL01300:Prex1 APN 2 166,480,327 (GRCm39) missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166,411,260 (GRCm39) splice site probably benign
IGL01753:Prex1 APN 2 166,444,802 (GRCm39) missense probably benign 0.11
IGL01819:Prex1 APN 2 166,463,165 (GRCm39) missense probably damaging 1.00
IGL02058:Prex1 APN 2 166,427,103 (GRCm39) missense probably benign 0.00
IGL02251:Prex1 APN 2 166,419,806 (GRCm39) missense probably damaging 0.99
IGL02326:Prex1 APN 2 166,463,105 (GRCm39) missense probably benign 0.35
IGL02366:Prex1 APN 2 166,422,347 (GRCm39) missense probably damaging 1.00
IGL02414:Prex1 APN 2 166,451,748 (GRCm39) missense probably damaging 1.00
IGL02660:Prex1 APN 2 166,435,787 (GRCm39) missense probably damaging 0.97
IGL02666:Prex1 APN 2 166,414,909 (GRCm39) missense probably benign 0.00
IGL02874:Prex1 APN 2 166,426,967 (GRCm39) missense probably damaging 1.00
IGL02935:Prex1 APN 2 166,412,265 (GRCm39) missense probably damaging 1.00
IGL03179:Prex1 APN 2 166,427,114 (GRCm39) missense probably benign 0.31
R0207:Prex1 UTSW 2 166,427,818 (GRCm39) missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166,428,619 (GRCm39) unclassified probably benign
R0420:Prex1 UTSW 2 166,431,491 (GRCm39) missense probably benign 0.13
R0449:Prex1 UTSW 2 166,411,297 (GRCm39) missense probably benign 0.16
R0458:Prex1 UTSW 2 166,427,743 (GRCm39) missense probably damaging 0.99
R0927:Prex1 UTSW 2 166,428,457 (GRCm39) missense probably benign 0.01
R1299:Prex1 UTSW 2 166,427,827 (GRCm39) missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166,435,781 (GRCm39) missense probably damaging 1.00
R1440:Prex1 UTSW 2 166,422,383 (GRCm39) missense probably damaging 0.98
R1506:Prex1 UTSW 2 166,429,001 (GRCm39) missense probably damaging 1.00
R1725:Prex1 UTSW 2 166,443,656 (GRCm39) missense probably damaging 1.00
R1831:Prex1 UTSW 2 166,427,021 (GRCm39) missense probably damaging 1.00
R1883:Prex1 UTSW 2 166,425,192 (GRCm39) missense probably benign 0.20
R1896:Prex1 UTSW 2 166,428,574 (GRCm39) missense probably benign 0.01
R2022:Prex1 UTSW 2 166,417,534 (GRCm39) missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166,411,285 (GRCm39) missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166,429,077 (GRCm39) missense probably benign 0.00
R2263:Prex1 UTSW 2 166,430,988 (GRCm39) splice site probably benign
R2276:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2279:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2680:Prex1 UTSW 2 166,443,692 (GRCm39) missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166,430,956 (GRCm39) missense probably benign 0.04
R3421:Prex1 UTSW 2 166,459,774 (GRCm39) missense probably damaging 1.00
R3614:Prex1 UTSW 2 166,451,701 (GRCm39) missense probably damaging 1.00
R4244:Prex1 UTSW 2 166,412,256 (GRCm39) missense probably damaging 1.00
R4605:Prex1 UTSW 2 166,555,464 (GRCm39) missense probably benign 0.45
R4685:Prex1 UTSW 2 166,480,252 (GRCm39) missense probably damaging 0.97
R4787:Prex1 UTSW 2 166,480,260 (GRCm39) missense probably benign 0.01
R4796:Prex1 UTSW 2 166,434,211 (GRCm39) missense probably damaging 1.00
R4825:Prex1 UTSW 2 166,427,777 (GRCm39) nonsense probably null
R4955:Prex1 UTSW 2 166,415,143 (GRCm39) missense probably damaging 0.99
R5046:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R5095:Prex1 UTSW 2 166,423,841 (GRCm39) missense probably damaging 1.00
R5408:Prex1 UTSW 2 166,417,573 (GRCm39) small insertion probably benign
R5462:Prex1 UTSW 2 166,486,728 (GRCm39) missense probably benign 0.02
R5535:Prex1 UTSW 2 166,422,193 (GRCm39) missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166,428,579 (GRCm39) missense probably damaging 1.00
R5813:Prex1 UTSW 2 166,425,127 (GRCm39) missense probably benign
R5860:Prex1 UTSW 2 166,486,604 (GRCm39) intron probably benign
R5984:Prex1 UTSW 2 166,427,664 (GRCm39) missense probably damaging 1.00
R6009:Prex1 UTSW 2 166,423,904 (GRCm39) missense probably damaging 1.00
R6174:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R6897:Prex1 UTSW 2 166,423,913 (GRCm39) missense probably damaging 0.99
R6935:Prex1 UTSW 2 166,441,575 (GRCm39) missense probably damaging 1.00
R7025:Prex1 UTSW 2 166,455,107 (GRCm39) small insertion probably benign
R7037:Prex1 UTSW 2 166,429,100 (GRCm39) missense probably benign 0.05
R7076:Prex1 UTSW 2 166,475,302 (GRCm39) missense probably damaging 0.99
R7181:Prex1 UTSW 2 166,412,291 (GRCm39) missense probably damaging 1.00
R7361:Prex1 UTSW 2 166,555,490 (GRCm39) missense probably benign 0.04
R7381:Prex1 UTSW 2 166,429,047 (GRCm39) missense probably damaging 1.00
R7721:Prex1 UTSW 2 166,419,810 (GRCm39) nonsense probably null
R7763:Prex1 UTSW 2 166,555,629 (GRCm39) missense unknown
R7809:Prex1 UTSW 2 166,415,164 (GRCm39) missense possibly damaging 0.91
R7915:Prex1 UTSW 2 166,463,112 (GRCm39) missense probably damaging 1.00
R7971:Prex1 UTSW 2 166,423,859 (GRCm39) missense probably damaging 1.00
R7998:Prex1 UTSW 2 166,428,965 (GRCm39) critical splice donor site probably null
R8029:Prex1 UTSW 2 166,417,523 (GRCm39) missense probably benign 0.01
R8193:Prex1 UTSW 2 166,435,780 (GRCm39) missense possibly damaging 0.60
R8352:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8452:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8927:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R8928:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R9021:Prex1 UTSW 2 166,432,429 (GRCm39) missense possibly damaging 0.47
R9070:Prex1 UTSW 2 166,427,707 (GRCm39) missense probably damaging 1.00
R9213:Prex1 UTSW 2 166,417,669 (GRCm39) missense probably damaging 0.99
R9511:Prex1 UTSW 2 166,413,481 (GRCm39) missense probably damaging 1.00
R9514:Prex1 UTSW 2 166,419,896 (GRCm39) missense possibly damaging 0.53
R9529:Prex1 UTSW 2 166,431,518 (GRCm39) missense probably damaging 1.00
X0065:Prex1 UTSW 2 166,428,545 (GRCm39) missense probably benign
Z1176:Prex1 UTSW 2 166,414,890 (GRCm39) nonsense probably null
Z1177:Prex1 UTSW 2 166,434,148 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGTACAATGGGTCAGC -3'
(R):5'- ATGGCTTCCACTTCTCCAGG -3'

Sequencing Primer
(F):5'- TGTACAATGGGTCAGCAGCGG -3'
(R):5'- TCAGGCTGCACACGGTG -3'
Posted On 2018-04-27