Incidental Mutation 'R6345:Strip1'
ID514093
Institutional Source Beutler Lab
Gene Symbol Strip1
Ensembl Gene ENSMUSG00000014601
Gene Namestriatin interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107612532-107631694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107628200 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 69 (E69G)
Ref Sequence ENSEMBL: ENSMUSP00000068587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064759] [ENSMUST00000106703]
Predicted Effect probably damaging
Transcript: ENSMUST00000064759
AA Change: E69G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068587
Gene: ENSMUSG00000014601
AA Change: E69G

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
N1221 65 363 7.87e-138 SMART
low complexity region 376 394 N/A INTRINSIC
DUF3402 460 817 6.87e-202 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198424
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the striatin-interacting phosphatase and kinase complex, which is involved in localization of the Golgi body. The encoded protein participates in cytosketelal organization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, shortened anterior-posterior axis, cinching of tissue at the embryonic/extraembryonic boundary and abnormal mesoderm development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Strip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Strip1 APN 3 107621445 missense probably damaging 0.99
IGL01150:Strip1 APN 3 107626731 splice site probably null
IGL01484:Strip1 APN 3 107613259 missense probably damaging 0.99
IGL01862:Strip1 APN 3 107621882 missense probably damaging 0.99
IGL02425:Strip1 APN 3 107614646 missense probably benign 0.08
IGL02537:Strip1 APN 3 107616894 missense possibly damaging 0.94
IGL02948:Strip1 APN 3 107613266 missense probably benign 0.33
IGL03179:Strip1 APN 3 107620255 missense probably damaging 0.99
PIT4472001:Strip1 UTSW 3 107628170 missense probably benign 0.19
R0197:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R0526:Strip1 UTSW 3 107620039 critical splice donor site probably null
R0543:Strip1 UTSW 3 107626775 missense possibly damaging 0.93
R0883:Strip1 UTSW 3 107614613 missense probably damaging 0.99
R1070:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1384:Strip1 UTSW 3 107626839 missense probably benign 0.00
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1467:Strip1 UTSW 3 107627408 missense possibly damaging 0.81
R1772:Strip1 UTSW 3 107626731 splice site probably null
R2358:Strip1 UTSW 3 107615819 missense probably benign 0.01
R2484:Strip1 UTSW 3 107628221 missense possibly damaging 0.81
R2931:Strip1 UTSW 3 107625659 intron probably null
R3427:Strip1 UTSW 3 107616822 missense possibly damaging 0.68
R4584:Strip1 UTSW 3 107624503 missense probably benign 0.39
R4780:Strip1 UTSW 3 107626998 missense probably benign 0.01
R4853:Strip1 UTSW 3 107616916 missense possibly damaging 0.93
R5623:Strip1 UTSW 3 107626826 missense possibly damaging 0.69
R5801:Strip1 UTSW 3 107621441 missense possibly damaging 0.50
R6860:Strip1 UTSW 3 107618936 missense possibly damaging 0.50
R6869:Strip1 UTSW 3 107613445 missense probably damaging 1.00
R7022:Strip1 UTSW 3 107626795 missense probably benign 0.09
R7192:Strip1 UTSW 3 107615335 missense possibly damaging 0.94
R7387:Strip1 UTSW 3 107625730 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCCAAATGTCCACATACGTG -3'
(R):5'- TGAAATACAGGGTGCTGGAC -3'

Sequencing Primer
(F):5'- TACGTGGTCCAACTTAAACAGC -3'
(R):5'- TGCTGGACAGGGCGTAAAG -3'
Posted On2018-04-27