Incidental Mutation 'R6345:Ankrd6'
ID514094
Institutional Source Beutler Lab
Gene Symbol Ankrd6
Ensembl Gene ENSMUSG00000040183
Gene Nameankyrin repeat domain 6
Synonymsdiversin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location32804035-32950841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32810266 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 437 (R437G)
Ref Sequence ENSEMBL: ENSMUSP00000081800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]
Predicted Effect probably damaging
Transcript: ENSMUST00000035719
AA Change: R472G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: R472G

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084748
AA Change: R437G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: R437G

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 269 2.11e2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 382 410 N/A INTRINSIC
low complexity region 501 521 N/A INTRINSIC
low complexity region 590 608 N/A INTRINSIC
coiled coil region 637 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084749
AA Change: R472G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: R472G

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084750
AA Change: R472G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: R472G

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108166
AA Change: R413G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: R413G

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 3.74e0 SMART
ANK 140 169 6.12e-5 SMART
ANK 173 202 5.32e-5 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
coiled coil region 358 386 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 561 579 N/A INTRINSIC
coiled coil region 608 648 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Ankrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02489:Ankrd6 APN 4 32810298 missense probably damaging 1.00
IGL03247:Ankrd6 APN 4 32860441 start codon destroyed possibly damaging 0.76
IGL03382:Ankrd6 APN 4 32808771 missense probably damaging 1.00
R0360:Ankrd6 UTSW 4 32836424 missense probably damaging 1.00
R0711:Ankrd6 UTSW 4 32815326 missense probably damaging 1.00
R1074:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1075:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1498:Ankrd6 UTSW 4 32810289 missense probably benign 0.17
R1719:Ankrd6 UTSW 4 32828774 missense probably damaging 1.00
R1823:Ankrd6 UTSW 4 32824427 missense probably damaging 1.00
R2889:Ankrd6 UTSW 4 32818704 missense probably damaging 0.99
R2897:Ankrd6 UTSW 4 32860438 missense probably damaging 0.98
R3815:Ankrd6 UTSW 4 32806206 missense probably benign 0.39
R3836:Ankrd6 UTSW 4 32817531 missense probably damaging 1.00
R4127:Ankrd6 UTSW 4 32822241 missense probably damaging 1.00
R4994:Ankrd6 UTSW 4 32860387 missense probably damaging 0.99
R5250:Ankrd6 UTSW 4 32860335 missense probably damaging 1.00
R5291:Ankrd6 UTSW 4 32823446 missense probably damaging 1.00
R5335:Ankrd6 UTSW 4 32818651 missense probably damaging 1.00
R5948:Ankrd6 UTSW 4 32817075 missense possibly damaging 0.91
R6336:Ankrd6 UTSW 4 32860411 missense probably damaging 1.00
R6349:Ankrd6 UTSW 4 32822231 missense probably damaging 1.00
R6516:Ankrd6 UTSW 4 32836427 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806419 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806420 missense probably damaging 1.00
R6999:Ankrd6 UTSW 4 32823459 missense probably benign
R7044:Ankrd6 UTSW 4 32815260 missense possibly damaging 0.93
R7307:Ankrd6 UTSW 4 32816949 missense possibly damaging 0.92
R7394:Ankrd6 UTSW 4 32821298 missense probably damaging 0.99
R7496:Ankrd6 UTSW 4 32810299 missense probably damaging 0.99
R7662:Ankrd6 UTSW 4 32818694 missense probably damaging 1.00
X0064:Ankrd6 UTSW 4 32806435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGACTACACATTCTTCGCTC -3'
(R):5'- TCGTGCTGTGAAATAGGGC -3'

Sequencing Primer
(F):5'- CTATGGAATGCAAATGGCCTCTGC -3'
(R):5'- CGTGCTGTGAAATAGGGCAGAAG -3'
Posted On2018-04-27