Incidental Mutation 'R6345:Rchy1'
ID514097
Institutional Source Beutler Lab
Gene Symbol Rchy1
Ensembl Gene ENSMUSG00000029397
Gene Namering finger and CHY zinc finger domain containing 1
SynonymsZfp363, Pirh2, 6720407C15Rik, PRO1996
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location91948904-91963068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91957942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 49 (D49G)
Ref Sequence ENSEMBL: ENSMUSP00000031345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031345] [ENSMUST00000169948]
PDB Structure
Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031345
AA Change: D49G

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031345
Gene: ENSMUSG00000029397
AA Change: D49G

DomainStartEndE-ValueType
Pfam:zf-CHY 20 93 2.2e-24 PFAM
low complexity region 119 130 N/A INTRINSIC
RING 145 186 1.38e-7 SMART
Pfam:zinc_ribbon_6 191 249 6.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140670
Predicted Effect probably benign
Transcript: ENSMUST00000169948
SMART Domains Protein: ENSMUSP00000131270
Gene: ENSMUSG00000029397

DomainStartEndE-ValueType
PDB:2DKT|A 10 99 2e-41 PDB
RING 105 146 1.38e-7 SMART
Pfam:zinc_ribbon_6 150 210 3.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202883
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a knock-out allele exhibit decreased cellular sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Rchy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Rchy1 APN 5 91957546 nonsense probably null
IGL02668:Rchy1 APN 5 91962718 start codon destroyed probably null 0.43
IGL03251:Rchy1 APN 5 91962643 missense probably benign 0.08
R0137:Rchy1 UTSW 5 91957599 missense probably benign 0.01
R0959:Rchy1 UTSW 5 91957617 missense probably damaging 0.99
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1531:Rchy1 UTSW 5 91955615 critical splice acceptor site probably null
R1868:Rchy1 UTSW 5 91951903 missense probably damaging 0.99
R4350:Rchy1 UTSW 5 91957954 missense probably damaging 1.00
R4953:Rchy1 UTSW 5 91962628 critical splice donor site probably null
R6223:Rchy1 UTSW 5 91957967 missense probably damaging 1.00
R6546:Rchy1 UTSW 5 91957958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGCTGGGCCTGAAAAG -3'
(R):5'- ATGTACCAAGAATGAACGCTGC -3'

Sequencing Primer
(F):5'- CTGGGCCTGAAAAGGACAC -3'
(R):5'- GAATGAACGCTGCCACGC -3'
Posted On2018-04-27