Incidental Mutation 'R6345:Ccdc61'
ID514105
Institutional Source Beutler Lab
Gene Symbol Ccdc61
Ensembl Gene ENSMUSG00000074358
Gene Namecoiled-coil domain containing 61
SynonymsC530028I08Rik, LOC232933
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R6345 (G1)
Quality Score99.0078
Status Validated
Chromosome7
Chromosomal Location18890883-18910415 bp(-) (GRCm38)
Type of Mutationintron (365 bp from exon)
DNA Base Change (assembly) A to T at 18909989 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098780] [ENSMUST00000135467] [ENSMUST00000139077] [ENSMUST00000150065]
Predicted Effect probably null
Transcript: ENSMUST00000098780
SMART Domains Protein: ENSMUSP00000096377
Gene: ENSMUSG00000074358

DomainStartEndE-ValueType
coiled coil region 173 206 N/A INTRINSIC
low complexity region 217 242 N/A INTRINSIC
coiled coil region 243 280 N/A INTRINSIC
low complexity region 290 332 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 400 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135467
Predicted Effect probably null
Transcript: ENSMUST00000139077
Predicted Effect probably benign
Transcript: ENSMUST00000150065
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Ccdc61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ccdc61 APN 7 18892558 missense probably benign
IGL02029:Ccdc61 APN 7 18903498 missense probably damaging 1.00
IGL02550:Ccdc61 APN 7 18893302 missense probably benign 0.03
I0000:Ccdc61 UTSW 7 18903549 missense probably damaging 1.00
R0055:Ccdc61 UTSW 7 18892536 missense probably damaging 1.00
R0055:Ccdc61 UTSW 7 18892536 missense probably damaging 1.00
R0392:Ccdc61 UTSW 7 18891102 missense probably benign 0.27
R0578:Ccdc61 UTSW 7 18903475 missense probably benign 0.02
R1740:Ccdc61 UTSW 7 18903937 splice site probably benign
R2230:Ccdc61 UTSW 7 18891107 missense probably damaging 0.98
R5964:Ccdc61 UTSW 7 18900940 missense probably damaging 1.00
R6893:Ccdc61 UTSW 7 18892563 missense possibly damaging 0.94
R7466:Ccdc61 UTSW 7 18891105 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATAAGACTCGTTCCCGACC -3'
(R):5'- CGGGGTCTTTAATGCATCATG -3'

Sequencing Primer
(F):5'- CTCGGCAGCAGTGGTAGAAC -3'
(R):5'- AATGCATCATGTTGTCGCTCG -3'
Posted On2018-04-27