Incidental Mutation 'R6345:Nell1'
ID514106
Institutional Source Beutler Lab
Gene Symbol Nell1
Ensembl Gene ENSMUSG00000055409
Gene NameNEL-like 1
SynonymsB230343H07Rik, l7R6
MMRRC Submission
Accession Numbers

Genbank: NM_001037906; MGI: 2443902

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6345 (G1)
Quality Score191.009
Status Validated
Chromosome7
Chromosomal Location49974864-50866608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49975423 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 12 (C12Y)
Ref Sequence ENSEMBL: ENSMUSP00000114706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]
Predicted Effect probably benign
Transcript: ENSMUST00000081872
AA Change: C12Y

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: C12Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_CA 549 595 1.08e-10 SMART
EGF_like 596 635 1.84e-4 SMART
VWC 634 686 1.42e0 SMART
VWC 694 749 1.83e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107603
AA Change: C12Y

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: C12Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_like 549 588 1.84e-4 SMART
VWC 587 639 1.42e0 SMART
VWC 647 702 1.83e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145096
Predicted Effect possibly damaging
Transcript: ENSMUST00000151721
AA Change: C12Y

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409
AA Change: C12Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype Strain: 3626314
Lethality: E19-E21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Nell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nell1 APN 7 50120673 missense probably damaging 0.96
IGL01434:Nell1 APN 7 50701208 missense probably benign 0.01
IGL01796:Nell1 APN 7 50176216 splice site probably benign
IGL02048:Nell1 APN 7 50219607 missense probably damaging 0.96
IGL02239:Nell1 APN 7 50249650 missense probably benign 0.08
IGL02860:Nell1 APN 7 50848485 missense probably damaging 0.99
IGL02958:Nell1 APN 7 50220337 critical splice donor site probably null
IGL03143:Nell1 APN 7 50279533 nonsense probably null
IGL03334:Nell1 APN 7 50062611 splice site probably null
D6062:Nell1 UTSW 7 50258191 missense probably benign 0.21
P0018:Nell1 UTSW 7 50120691 missense probably damaging 1.00
R0004:Nell1 UTSW 7 50560759 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0468:Nell1 UTSW 7 50228846 missense probably damaging 0.97
R0483:Nell1 UTSW 7 50230180 missense probably benign 0.07
R0732:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R0945:Nell1 UTSW 7 50219585 missense probably benign 0.07
R1022:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1024:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1075:Nell1 UTSW 7 50853840 missense probably damaging 0.98
R1291:Nell1 UTSW 7 50230250 missense probably benign 0.00
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1634:Nell1 UTSW 7 50848558 missense possibly damaging 0.82
R1928:Nell1 UTSW 7 50701195 missense possibly damaging 0.51
R2060:Nell1 UTSW 7 50560830 missense possibly damaging 0.58
R2261:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2262:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2263:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2448:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R2869:Nell1 UTSW 7 50249657 intron probably benign
R2870:Nell1 UTSW 7 50249657 intron probably benign
R2871:Nell1 UTSW 7 50249657 intron probably benign
R3498:Nell1 UTSW 7 50258179 missense possibly damaging 0.55
R4044:Nell1 UTSW 7 50219619 missense probably damaging 1.00
R4623:Nell1 UTSW 7 50120562 missense possibly damaging 0.84
R4732:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4733:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4941:Nell1 UTSW 7 50062638 missense probably benign 0.10
R4942:Nell1 UTSW 7 50120649 missense possibly damaging 0.84
R5233:Nell1 UTSW 7 50176314 missense probably damaging 0.99
R5590:Nell1 UTSW 7 50279611 missense probably damaging 1.00
R5673:Nell1 UTSW 7 50228846 missense probably damaging 0.99
R5741:Nell1 UTSW 7 50560890 unclassified probably null
R6916:Nell1 UTSW 7 50701179 missense probably benign 0.00
R7051:Nell1 UTSW 7 50448844 missense unknown
R7302:Nell1 UTSW 7 50856269 missense probably benign
R7339:Nell1 UTSW 7 50279549 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAACTGTTGCAACTTGGGC -3'
(R):5'- CTGTGCTGGGCAATCAGAAC -3'

Sequencing Primer
(F):5'- TAGCCGGGATCCTTGCATC -3'
(R):5'- GGGCAATCAGAACCCAAGC -3'
Posted On2018-04-27