Incidental Mutation 'R6345:Mtrf1l'
ID514111
Institutional Source Beutler Lab
Gene Symbol Mtrf1l
Ensembl Gene ENSMUSG00000019774
Gene Namemitochondrial translational release factor 1-like
Synonyms9130004K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location5811887-5823910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5817468 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 216 (I216N)
Ref Sequence ENSEMBL: ENSMUSP00000019908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019908]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019908
AA Change: I216N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019908
Gene: ENSMUSG00000019774
AA Change: I216N

DomainStartEndE-ValueType
PCRF 75 189 2.26e-36 SMART
Pfam:RF-1 221 331 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145718
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Mtrf1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Mtrf1l APN 10 5814180 splice site probably benign
IGL01292:Mtrf1l APN 10 5814090 missense probably benign 0.00
IGL01844:Mtrf1l APN 10 5814112 missense probably null 0.76
R0050:Mtrf1l UTSW 10 5815553 splice site silent
R0051:Mtrf1l UTSW 10 5813382 missense probably damaging 1.00
R0051:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R0866:Mtrf1l UTSW 10 5813376 missense probably damaging 1.00
R1636:Mtrf1l UTSW 10 5813265 missense probably damaging 0.98
R2897:Mtrf1l UTSW 10 5817565 missense probably benign 0.16
R4020:Mtrf1l UTSW 10 5817454 missense probably benign 0.01
R4618:Mtrf1l UTSW 10 5817586 missense probably benign 0.37
R4843:Mtrf1l UTSW 10 5823696 missense possibly damaging 0.56
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6034:Mtrf1l UTSW 10 5823834 unclassified probably benign
R6261:Mtrf1l UTSW 10 5815550 critical splice donor site probably null
R6991:Mtrf1l UTSW 10 5813384 missense probably damaging 1.00
R7669:Mtrf1l UTSW 10 5815620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGACTTACAATGTCCATTTCATG -3'
(R):5'- TGGTCAATTGTTTCTGCACGAC -3'

Sequencing Primer
(F):5'- CCAGTGTATATCTAGACAGTCGAG -3'
(R):5'- TTAGACATGCGTCAGCCA -3'
Posted On2018-04-27