Incidental Mutation 'R6345:Pah'
ID514114
Institutional Source Beutler Lab
Gene Symbol Pah
Ensembl Gene ENSMUSG00000020051
Gene Namephenylalanine hydroxylase
SynonymsAW106920, OTTMUSP00000027786, PH, PKU, PKU1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location87521795-87584136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87576187 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 315 (D315N)
Ref Sequence ENSEMBL: ENSMUSP00000020241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020241] [ENSMUST00000219813]
Predicted Effect probably damaging
Transcript: ENSMUST00000020241
AA Change: D315N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020241
Gene: ENSMUSG00000020051
AA Change: D315N

DomainStartEndE-ValueType
Pfam:ACT 35 100 1.8e-10 PFAM
Pfam:Biopterin_H 119 449 1.3e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218573
Predicted Effect probably benign
Transcript: ENSMUST00000219813
Meta Mutation Damage Score 0.9347 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Pah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Pah APN 10 87578893 missense probably benign 0.02
IGL00823:Pah APN 10 87570331 missense probably null 1.00
IGL01350:Pah APN 10 87578359 intron probably benign
IGL01668:Pah APN 10 87578261 missense probably damaging 1.00
IGL01794:Pah APN 10 87578922 missense possibly damaging 0.63
IGL01956:Pah APN 10 87538199 missense probably benign 0.03
IGL01985:Pah APN 10 87578982 missense probably damaging 1.00
IGL02014:Pah APN 10 87581927 missense probably benign 0.00
IGL02552:Pah APN 10 87578845 intron probably benign
IGL03096:Pah APN 10 87538242 critical splice donor site probably null
bronze UTSW 10 87570226 missense probably damaging 1.00
parakeet UTSW 10 87576215 critical splice donor site probably null
skeet UTSW 10 87538219 nonsense probably null
R0238:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0839:Pah UTSW 10 87522062 missense probably damaging 1.00
R0853:Pah UTSW 10 87576218 splice site probably null
R1474:Pah UTSW 10 87578313 missense probably damaging 1.00
R1762:Pah UTSW 10 87567468 missense possibly damaging 0.91
R1886:Pah UTSW 10 87528328 missense possibly damaging 0.91
R2179:Pah UTSW 10 87567335 missense probably damaging 1.00
R2852:Pah UTSW 10 87567465 missense probably damaging 1.00
R3818:Pah UTSW 10 87522004 start gained probably benign
R4509:Pah UTSW 10 87576215 critical splice donor site probably null
R4725:Pah UTSW 10 87554376 missense probably damaging 1.00
R4911:Pah UTSW 10 87570267 missense probably benign 0.42
R5094:Pah UTSW 10 87538219 nonsense probably null
R5766:Pah UTSW 10 87567347 missense probably damaging 1.00
R6210:Pah UTSW 10 87583561 missense probably benign 0.01
R6273:Pah UTSW 10 87576215 critical splice donor site probably null
R6349:Pah UTSW 10 87578969 missense probably benign 0.01
R7109:Pah UTSW 10 87570286 missense probably damaging 1.00
R7470:Pah UTSW 10 87563424 missense probably damaging 1.00
R7511:Pah UTSW 10 87554387 missense probably damaging 1.00
Z1088:Pah UTSW 10 87571291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGATGTCTAACAATATTCAGGG -3'
(R):5'- TGAGAATATCCACATGCAAGCTG -3'

Sequencing Primer
(F):5'- GTCTATCTGGACCCTTCAGAAG -3'
(R):5'- GCAAGCTGATATAAAAGTCAGTCC -3'
Posted On2018-04-27