Incidental Mutation 'R6345:S1pr3'
ID514122
Institutional Source Beutler Lab
Gene Symbol S1pr3
Ensembl Gene ENSMUSG00000067586
Gene Namesphingosine-1-phosphate receptor 3
SynonymsLPb3, Edg3, S1P3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location51408639-51422797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 51419031 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 83 (A83S)
Ref Sequence ENSEMBL: ENSMUSP00000085293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087978]
Predicted Effect probably damaging
Transcript: ENSMUST00000087978
AA Change: A83S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085293
Gene: ENSMUSG00000067586
AA Change: A83S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 51 313 1.8e-12 PFAM
Pfam:7tm_1 57 298 8.8e-39 PFAM
low complexity region 334 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222417
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor 1 family. The encoded protein is a receptor for the lysophospholipid sphingosine 1-phosphate. The gene product functions in endothelial cells and is involved in vascular and heart development. The gene product mediates HDL and HDL-associated lysophospholipid-induced vasorelaxation, and it coordinates with other lysophospholipid receptors in the process of angiogenesis. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype although litter sizes are reduced. Susceptibility to pulmonary edema is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in S1pr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:S1pr3 APN 13 51419512 missense probably damaging 1.00
IGL01997:S1pr3 APN 13 51419715 missense probably damaging 1.00
IGL02270:S1pr3 APN 13 51419056 missense probably benign 0.03
R0242:S1pr3 UTSW 13 51418902 missense probably benign 0.00
R0242:S1pr3 UTSW 13 51418902 missense probably benign 0.00
R0584:S1pr3 UTSW 13 51419661 missense probably benign 0.00
R1869:S1pr3 UTSW 13 51419916 missense probably benign 0.01
R1870:S1pr3 UTSW 13 51419916 missense probably benign 0.01
R2338:S1pr3 UTSW 13 51419578 missense possibly damaging 0.76
R5472:S1pr3 UTSW 13 51419647 missense probably damaging 1.00
R6006:S1pr3 UTSW 13 51419695 missense probably damaging 1.00
R6345:S1pr3 UTSW 13 51419032 missense probably damaging 1.00
R6702:S1pr3 UTSW 13 51419439 missense probably damaging 1.00
R6703:S1pr3 UTSW 13 51419439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCAGTCTTGGGAAATGACAC -3'
(R):5'- TGATCATGGTCAGGTGTCGC -3'

Sequencing Primer
(F):5'- TTGGGAAATGACACTCTCCG -3'
(R):5'- CAGGTGTCGCTCAATGGCAATG -3'
Posted On2018-04-27