Incidental Mutation 'R6345:Plekhh2'
ID514135
Institutional Source Beutler Lab
Gene Symbol Plekhh2
Ensembl Gene ENSMUSG00000040852
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location84511895-84622142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84575787 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 761 (N761S)
Ref Sequence ENSEMBL: ENSMUSP00000039628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047206]
Predicted Effect probably benign
Transcript: ENSMUST00000047206
AA Change: N761S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: N761S

DomainStartEndE-ValueType
coiled coil region 19 84 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
coiled coil region 137 174 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
low complexity region 612 651 N/A INTRINSIC
low complexity region 657 666 N/A INTRINSIC
PH 703 798 4.7e-19 SMART
PH 811 920 1.15e-4 SMART
MyTH4 954 1109 8.49e-39 SMART
B41 1116 1353 1.01e-27 SMART
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
Ric1 A G 19: 29,604,085 D1402G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Plekhh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Plekhh2 APN 17 84521775 missense probably benign 0.00
IGL00514:Plekhh2 APN 17 84596306 critical splice donor site probably null
IGL00773:Plekhh2 APN 17 84606868 missense probably benign 0.01
IGL00985:Plekhh2 APN 17 84563928 missense probably benign 0.00
IGL01116:Plekhh2 APN 17 84606928 missense possibly damaging 0.94
IGL01394:Plekhh2 APN 17 84557430 missense probably benign 0.24
IGL01419:Plekhh2 APN 17 84583552 splice site probably benign
IGL01932:Plekhh2 APN 17 84577261 missense probably benign 0.00
IGL02097:Plekhh2 APN 17 84599180 missense possibly damaging 0.69
IGL02157:Plekhh2 APN 17 84566942 splice site probably benign
IGL02163:Plekhh2 APN 17 84590795 missense probably benign 0.45
IGL02237:Plekhh2 APN 17 84575785 missense probably benign 0.00
IGL02322:Plekhh2 APN 17 84589466 nonsense probably null
IGL02422:Plekhh2 APN 17 84563809 splice site probably benign
IGL02483:Plekhh2 APN 17 84596260 missense possibly damaging 0.81
IGL02493:Plekhh2 APN 17 84606963 critical splice donor site probably null
IGL03007:Plekhh2 APN 17 84574960 missense possibly damaging 0.65
R0003:Plekhh2 UTSW 17 84557392 missense probably damaging 1.00
R0005:Plekhh2 UTSW 17 84586433 missense probably benign 0.16
R0099:Plekhh2 UTSW 17 84591672 nonsense probably null
R0331:Plekhh2 UTSW 17 84586366 missense possibly damaging 0.81
R0883:Plekhh2 UTSW 17 84618031 missense probably benign 0.11
R1051:Plekhh2 UTSW 17 84521827 critical splice donor site probably null
R1084:Plekhh2 UTSW 17 84571126 missense probably damaging 0.99
R1351:Plekhh2 UTSW 17 84577146 splice site probably benign
R1459:Plekhh2 UTSW 17 84610775 nonsense probably null
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1510:Plekhh2 UTSW 17 84559576 splice site probably null
R1699:Plekhh2 UTSW 17 84577184 nonsense probably null
R1738:Plekhh2 UTSW 17 84566697 missense possibly damaging 0.67
R1773:Plekhh2 UTSW 17 84599265 missense probably damaging 1.00
R1796:Plekhh2 UTSW 17 84599133 critical splice acceptor site probably null
R1823:Plekhh2 UTSW 17 84575189 missense probably damaging 1.00
R1998:Plekhh2 UTSW 17 84606877 missense possibly damaging 0.58
R2437:Plekhh2 UTSW 17 84586479 splice site probably null
R2847:Plekhh2 UTSW 17 84597966 missense probably damaging 1.00
R4088:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R4227:Plekhh2 UTSW 17 84566795 missense probably benign 0.00
R4249:Plekhh2 UTSW 17 84586337 missense possibly damaging 0.93
R4347:Plekhh2 UTSW 17 84619702 missense probably benign 0.12
R4562:Plekhh2 UTSW 17 84566097 missense probably benign 0.00
R4649:Plekhh2 UTSW 17 84575263 missense probably damaging 1.00
R4737:Plekhh2 UTSW 17 84563959 missense probably benign
R4743:Plekhh2 UTSW 17 84571120 missense probably damaging 1.00
R4858:Plekhh2 UTSW 17 84600697 missense probably damaging 1.00
R5036:Plekhh2 UTSW 17 84571761 missense probably damaging 0.99
R5260:Plekhh2 UTSW 17 84577165 missense probably damaging 0.99
R5385:Plekhh2 UTSW 17 84557466 missense probably benign 0.00
R5409:Plekhh2 UTSW 17 84586478 critical splice donor site probably null
R5510:Plekhh2 UTSW 17 84566847 missense probably benign
R5557:Plekhh2 UTSW 17 84560152 missense probably benign 0.10
R5684:Plekhh2 UTSW 17 84597918 missense probably damaging 1.00
R5685:Plekhh2 UTSW 17 84569882 missense probably damaging 1.00
R5724:Plekhh2 UTSW 17 84566805 missense probably benign 0.00
R5742:Plekhh2 UTSW 17 84597980 missense probably damaging 1.00
R5817:Plekhh2 UTSW 17 84571726 missense possibly damaging 0.86
R6218:Plekhh2 UTSW 17 84591564 missense probably benign 0.03
R6334:Plekhh2 UTSW 17 84566866 missense probably benign
R6617:Plekhh2 UTSW 17 84566287 missense possibly damaging 0.65
R6755:Plekhh2 UTSW 17 84591585 missense probably damaging 1.00
R6864:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R7171:Plekhh2 UTSW 17 84521788 missense probably damaging 0.96
R7413:Plekhh2 UTSW 17 84566296 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTAGGGCCTGAGTTCCTCAC -3'
(R):5'- CAGCCTGATATTTTGAGAGCTG -3'

Sequencing Primer
(F):5'- CTCGTGAAGTGTAGACATACATGCC -3'
(R):5'- CCTGATATTTTGAGAGCTGGAAATGC -3'
Posted On2018-04-27