Incidental Mutation 'R6345:Ric1'
ID514137
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R6345 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29604085 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1402 (D1402G)
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610] [ENSMUST00000159692]
Predicted Effect probably benign
Transcript: ENSMUST00000043610
AA Change: D1402G

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: D1402G

DomainStartEndE-ValueType
Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159692
SMART Domains Protein: ENSMUSP00000124881
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 65 94 N/A INTRINSIC
Pfam:Peptidase_M28 179 373 1.3e-49 PFAM
Pfam:Peptidase_M20 184 375 2.9e-8 PFAM
transmembrane domain 405 427 N/A INTRINSIC
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 481 503 N/A INTRINSIC
transmembrane domain 516 538 N/A INTRINSIC
transmembrane domain 543 562 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160452
SMART Domains Protein: ENSMUSP00000125299
Gene: ENSMUSG00000038658

DomainStartEndE-ValueType
Pfam:RIC1 8 163 1.4e-60 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161330
AA Change: D423G
SMART Domains Protein: ENSMUSP00000125709
Gene: ENSMUSG00000038658
AA Change: D423G

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161749
Predicted Effect unknown
Transcript: ENSMUST00000162492
AA Change: D1293G
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: D1293G

DomainStartEndE-ValueType
Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,051 I121T probably benign Het
4921524L21Rik T A 18: 6,626,399 M137K possibly damaging Het
Angpt4 C A 2: 151,929,434 N223K probably benign Het
Ankrd6 T C 4: 32,810,266 R437G probably damaging Het
Atp9a C T 2: 168,676,173 S264N probably damaging Het
AY358078 A C 14: 51,826,292 Y465S probably damaging Het
Bin3 G A 14: 70,137,227 R235Q probably benign Het
Bsn G A 9: 108,107,355 P3167S unknown Het
Camk2g G A 14: 20,737,375 R274C probably damaging Het
Ccdc61 A T 7: 18,909,989 probably null Het
Ccnjl A T 11: 43,585,338 T263S probably benign Het
Col17a1 G T 19: 47,653,379 P944T possibly damaging Het
Cyp2c39 A T 19: 39,513,171 probably null Het
Cyp2c39 G T 19: 39,513,172 probably null Het
Cyp4a32 T C 4: 115,602,363 V98A possibly damaging Het
D430042O09Rik C A 7: 125,752,987 D26E probably damaging Het
Dnah9 A G 11: 66,037,693 V2050A probably damaging Het
F5 A G 1: 164,191,951 N665S probably benign Het
Fbxl6 A T 15: 76,535,854 C520S probably damaging Het
Fscn2 C A 11: 120,362,027 H107N probably damaging Het
Gfm2 C T 13: 97,162,953 T367M probably damaging Het
Gle1 C G 2: 29,936,115 P69A probably benign Het
Gpr156 A T 16: 37,987,519 D176V probably damaging Het
Grip2 A G 6: 91,765,388 S895P possibly damaging Het
Hfm1 C T 5: 106,841,638 G1404D probably benign Het
Ifit1bl1 G A 19: 34,594,170 R296* probably null Het
Ighv1-39 C T 12: 114,914,859 V31M possibly damaging Het
Itgav A G 2: 83,802,036 E956G probably damaging Het
Lsm8 A G 6: 18,853,645 D86G probably damaging Het
Mdh1b T G 1: 63,715,239 H390P possibly damaging Het
Mtrf1l A T 10: 5,817,468 I216N possibly damaging Het
Muc16 G A 9: 18,654,926 T2099I unknown Het
Myh7 T C 14: 54,983,692 R925G probably damaging Het
Myo1h T A 5: 114,351,708 I658N probably damaging Het
Myo5a A T 9: 75,189,913 D81V possibly damaging Het
Nell1 G A 7: 49,975,423 C12Y possibly damaging Het
Obscn T C 11: 59,053,696 Y4724C probably damaging Het
Olfr1055 A G 2: 86,347,548 Y73H probably damaging Het
Pah G A 10: 87,576,187 D315N probably damaging Het
Per2 A G 1: 91,448,722 V143A probably damaging Het
Plcxd1 T C 5: 110,100,299 V38A probably benign Het
Pld1 A G 3: 28,130,747 probably benign Het
Plekhh2 A G 17: 84,575,787 N761S probably benign Het
Polh T C 17: 46,182,738 I318V probably benign Het
Prex1 T C 2: 166,572,960 Q1323R probably null Het
Rb1cc1 T A 1: 6,263,257 S1440T probably benign Het
Rbm19 G T 5: 120,127,040 W382L possibly damaging Het
Rchy1 T C 5: 91,957,942 D49G probably benign Het
S1pr3 G T 13: 51,419,031 A83S probably damaging Het
S1pr3 C A 13: 51,419,032 A83D probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Serpinb9c T C 13: 33,149,995 R355G probably damaging Het
Slx4 G C 16: 3,990,850 Q409E probably benign Het
Sntg1 A C 1: 8,583,284 L243R possibly damaging Het
Specc1l G T 10: 75,248,488 D682Y probably damaging Het
Spen C T 4: 141,471,633 V3228I possibly damaging Het
Strip1 T C 3: 107,628,200 E69G probably damaging Het
Tasp1 C A 2: 139,951,537 V240L probably damaging Het
Tdrd9 T A 12: 112,034,608 F787L probably damaging Het
Vmn1r228 A G 17: 20,776,882 S125P probably damaging Het
Wdhd1 A G 14: 47,251,922 M718T probably damaging Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0336:Ric1 UTSW 19 29587793 missense probably damaging 0.96
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4004:Ric1 UTSW 19 29579801 missense probably benign 0.44
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4283:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R5965:Ric1 UTSW 19 29570771 missense probably damaging 0.99
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7296:Ric1 UTSW 19 29584578 critical splice donor site probably null
R7434:Ric1 UTSW 19 29574780 missense probably damaging 1.00
R7619:Ric1 UTSW 19 29579775 missense probably benign 0.32
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACTCAGCCCTGGATATAAGC -3'
(R):5'- GAGTTCTGACCCAAGTTCTTTTACC -3'

Sequencing Primer
(F):5'- ACAACTGCAGAAGCTCAGTG -3'
(R):5'- ACCTGTTAAGTCATTCGGCAG -3'
Posted On2018-04-27