Mutagenetix > Incidental Mutation

Incidental Mutation 'R6345:Ifit1bl1'

514138

Institutional Source

Beutler Lab

Gene Symbol

Ifit1bl1

Ensembl Gene

ENSMUSG00000079339

Gene Name

interferon induced protein with tetratricpeptide repeats 1B like 1

Synonyms

Gm14446

MMRRC Submission

044499-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6345 (G1)

Quality Score

110.008

Status

Validated

Chromosome

Chromosomal Location

34592888-34601968 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 34594170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 296 (R296*)

Ref Sequence

ENSEMBL: ENSMUSP00000132781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]

AlphaFold

D3Z6F0

Predicted Effect

probably null
Transcript: ENSMUST00000112467
AA Change: R296*

SMART Domains

Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: R296*

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000168254
AA Change: R296*

SMART Domains

Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: R296*

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

100% (61/61)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,226,051	I121T	probably benign	Het
4921524L21Rik	T	A	18: 6,626,399	M137K	possibly damaging	Het
Angpt4	C	A	2: 151,929,434	N223K	probably benign	Het
Ankrd6	T	C	4: 32,810,266	R437G	probably damaging	Het
Atp9a	C	T	2: 168,676,173	S264N	probably damaging	Het
AY358078	A	C	14: 51,826,292	Y465S	probably damaging	Het
Bin3	G	A	14: 70,137,227	R235Q	probably benign	Het
Bsn	G	A	9: 108,107,355	P3167S	unknown	Het
Camk2g	G	A	14: 20,737,375	R274C	probably damaging	Het
Ccdc61	A	T	7: 18,909,989		probably null	Het
Ccnjl	A	T	11: 43,585,338	T263S	probably benign	Het
Col17a1	G	T	19: 47,653,379	P944T	possibly damaging	Het
Cyp2c39	A	T	19: 39,513,171		probably null	Het
Cyp2c39	G	T	19: 39,513,172		probably null	Het
Cyp4a32	T	C	4: 115,602,363	V98A	possibly damaging	Het
D430042O09Rik	C	A	7: 125,752,987	D26E	probably damaging	Het
Dnah9	A	G	11: 66,037,693	V2050A	probably damaging	Het
F5	A	G	1: 164,191,951	N665S	probably benign	Het
Fbxl6	A	T	15: 76,535,854	C520S	probably damaging	Het
Fscn2	C	A	11: 120,362,027	H107N	probably damaging	Het
Gfm2	C	T	13: 97,162,953	T367M	probably damaging	Het
Gle1	C	G	2: 29,936,115	P69A	probably benign	Het
Gpr156	A	T	16: 37,987,519	D176V	probably damaging	Het
Grip2	A	G	6: 91,765,388	S895P	possibly damaging	Het
Hfm1	C	T	5: 106,841,638	G1404D	probably benign	Het
Ighv1-39	C	T	12: 114,914,859	V31M	possibly damaging	Het
Itgav	A	G	2: 83,802,036	E956G	probably damaging	Het
Lsm8	A	G	6: 18,853,645	D86G	probably damaging	Het
Mdh1b	T	G	1: 63,715,239	H390P	possibly damaging	Het
Mtrf1l	A	T	10: 5,817,468	I216N	possibly damaging	Het
Muc16	G	A	9: 18,654,926	T2099I	unknown	Het
Myh7	T	C	14: 54,983,692	R925G	probably damaging	Het
Myo1h	T	A	5: 114,351,708	I658N	probably damaging	Het
Myo5a	A	T	9: 75,189,913	D81V	possibly damaging	Het
Nell1	G	A	7: 49,975,423	C12Y	possibly damaging	Het
Obscn	T	C	11: 59,053,696	Y4724C	probably damaging	Het
Olfr1055	A	G	2: 86,347,548	Y73H	probably damaging	Het
Pah	G	A	10: 87,576,187	D315N	probably damaging	Het
Per2	A	G	1: 91,448,722	V143A	probably damaging	Het
Plcxd1	T	C	5: 110,100,299	V38A	probably benign	Het
Pld1	A	G	3: 28,130,747		probably benign	Het
Plekhh2	A	G	17: 84,575,787	N761S	probably benign	Het
Polh	T	C	17: 46,182,738	I318V	probably benign	Het
Prex1	T	C	2: 166,572,960	Q1323R	probably null	Het
Rb1cc1	T	A	1: 6,263,257	S1440T	probably benign	Het
Rbm19	G	T	5: 120,127,040	W382L	possibly damaging	Het
Rchy1	T	C	5: 91,957,942	D49G	probably benign	Het
Ric1	A	G	19: 29,604,085	D1402G	probably benign	Het
S1pr3	G	T	13: 51,419,031	A83S	probably damaging	Het
S1pr3	C	A	13: 51,419,032	A83D	probably damaging	Het
Selplg	G	A	5: 113,820,149	P32L	probably benign	Het
Serpinb9c	T	C	13: 33,149,995	R355G	probably damaging	Het
Slx4	G	C	16: 3,990,850	Q409E	probably benign	Het
Sntg1	A	C	1: 8,583,284	L243R	possibly damaging	Het
Specc1l	G	T	10: 75,248,488	D682Y	probably damaging	Het
Spen	C	T	4: 141,471,633	V3228I	possibly damaging	Het
Strip1	T	C	3: 107,628,200	E69G	probably damaging	Het
Tasp1	C	A	2: 139,951,537	V240L	probably damaging	Het
Tdrd9	T	A	12: 112,034,608	F787L	probably damaging	Het
Vmn1r228	A	G	17: 20,776,882	S125P	probably damaging	Het
Wdhd1	A	G	14: 47,251,922	M718T	probably damaging	Het

Other mutations in Ifit1bl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4544001:Ifit1bl1	UTSW	19	34594015	missense	possibly damaging	0.79
R0420:Ifit1bl1	UTSW	19	34594514	missense	probably damaging	1.00
R1161:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1310:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1483:Ifit1bl1	UTSW	19	34594641	missense	possibly damaging	0.88
R1606:Ifit1bl1	UTSW	19	34594044	missense	probably benign	0.00
R1753:Ifit1bl1	UTSW	19	34593860	missense	probably benign	0.15
R1778:Ifit1bl1	UTSW	19	34594193	missense	probably damaging	1.00
R2204:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2205:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2442:Ifit1bl1	UTSW	19	34594889	missense	probably benign	0.00
R2858:Ifit1bl1	UTSW	19	34594322	missense	probably benign	0.01
R3422:Ifit1bl1	UTSW	19	34593950	missense	probably benign	0.04
R4081:Ifit1bl1	UTSW	19	34594640	missense	possibly damaging	0.63
R4125:Ifit1bl1	UTSW	19	34594788	missense	probably damaging	0.99
R4616:Ifit1bl1	UTSW	19	34594610	missense	probably damaging	1.00
R4731:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4732:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4849:Ifit1bl1	UTSW	19	34594676	missense	probably damaging	1.00
R5026:Ifit1bl1	UTSW	19	34593893	missense	probably damaging	1.00
R5049:Ifit1bl1	UTSW	19	34594081	nonsense	probably null
R5414:Ifit1bl1	UTSW	19	34593924	missense	probably damaging	0.99
R5561:Ifit1bl1	UTSW	19	34593797	nonsense	probably null
R5586:Ifit1bl1	UTSW	19	34594277	missense	probably damaging	0.98
R6382:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R6515:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R7073:Ifit1bl1	UTSW	19	34599267	critical splice donor site	probably null
R7180:Ifit1bl1	UTSW	19	34593902	missense	probably damaging	1.00
R7210:Ifit1bl1	UTSW	19	34594164	missense	probably benign	0.00
R7665:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R7724:Ifit1bl1	UTSW	19	34594005	missense	probably benign	0.00
R7783:Ifit1bl1	UTSW	19	34593936	missense	probably benign	0.01
R7944:Ifit1bl1	UTSW	19	34593824	missense	probably benign	0.00
R8251:Ifit1bl1	UTSW	19	34594832	missense	possibly damaging	0.85
R8427:Ifit1bl1	UTSW	19	34599266	critical splice donor site	probably null
R8474:Ifit1bl1	UTSW	19	34594862	missense	probably damaging	1.00
R8933:Ifit1bl1	UTSW	19	34594013	missense	probably damaging	0.99
R9095:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R9282:Ifit1bl1	UTSW	19	34594508	missense	probably benign	0.28
R9314:Ifit1bl1	UTSW	19	34599293	missense	probably benign	0.08
R9432:Ifit1bl1	UTSW	19	34594098	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TACCGGAAGTGAATCTCTTGC -3'
(R):5'- GAAACTCTGCCCAGGATATCC -3'

Sequencing Primer
(F):5'- CGGAAGTGAATCTCTTGCTGAATATG -3'
(R):5'- AGGATATCCTCGCAGCCCTATG -3'

Posted On

2018-04-27