Incidental Mutation 'R6350:Olfr1318'
ID514142
Institutional Source Beutler Lab
Gene Symbol Olfr1318
Ensembl Gene ENSMUSG00000049758
Gene Nameolfactory receptor 1318
SynonymsMOR245-16, GA_x6K02T2Q125-73202172-73203134
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112154198-112159157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112156197 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 82 (I82N)
Ref Sequence ENSEMBL: ENSMUSP00000151164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058176] [ENSMUST00000214063] [ENSMUST00000217533]
Predicted Effect probably damaging
Transcript: ENSMUST00000058176
AA Change: I82N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051938
Gene: ENSMUSG00000049758
AA Change: I82N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.4e-39 PFAM
Pfam:7tm_1 41 287 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214063
AA Change: I82N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216873
Predicted Effect probably damaging
Transcript: ENSMUST00000217533
AA Change: I82N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Olfr1318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1318 APN 2 112156067 missense probably benign
IGL00923:Olfr1318 APN 2 112156777 missense possibly damaging 0.75
IGL02800:Olfr1318 APN 2 112156244 missense possibly damaging 0.95
R0012:Olfr1318 UTSW 2 112156826 missense possibly damaging 0.84
R1614:Olfr1318 UTSW 2 112156517 missense probably damaging 1.00
R1989:Olfr1318 UTSW 2 112156377 missense probably benign 0.00
R2428:Olfr1318 UTSW 2 112156442 missense probably benign 0.03
R2963:Olfr1318 UTSW 2 112156459 nonsense probably null
R4868:Olfr1318 UTSW 2 112156571 missense probably damaging 0.99
R4960:Olfr1318 UTSW 2 112156352 missense probably benign 0.00
R5121:Olfr1318 UTSW 2 112156286 missense possibly damaging 0.47
R6218:Olfr1318 UTSW 2 112156356 missense probably damaging 0.99
R6294:Olfr1318 UTSW 2 112156019 missense probably benign
R6515:Olfr1318 UTSW 2 112156365 missense probably benign 0.00
R6722:Olfr1318 UTSW 2 112156882 missense probably benign
R6829:Olfr1318 UTSW 2 112155794 intron probably benign
R7186:Olfr1318 UTSW 2 112156162 missense probably damaging 1.00
R7206:Olfr1318 UTSW 2 112156459 missense probably damaging 1.00
R7444:Olfr1318 UTSW 2 112156715 missense probably damaging 1.00
R8293:Olfr1318 UTSW 2 112156253 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCTAGGCCTCACCAATTC -3'
(R):5'- GCCAATGATCCAAGCAAGAG -3'

Sequencing Primer
(F):5'- GGAACCTGCTCATTGTG -3'
(R):5'- CAATGCACATTCTGAGACTCATG -3'
Posted On2018-04-27