Incidental Mutation 'R6350:Ptpra'
ID514143
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Nameprotein tyrosine phosphatase, receptor type, A
SynonymsPTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130450278-130556124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130540592 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 451 (L451P)
Ref Sequence ENSEMBL: ENSMUSP00000076533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303] [ENSMUST00000230981]
PDB Structure
Crystal structure of the D2 domain of RPTPa [X-RAY DIFFRACTION]
RECEPTOR PROTEIN TYROSINE PHOSPHATASE ALPHA, DOMAIN 1 FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028769
AA Change: L415P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: L415P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077303
AA Change: L451P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: L451P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230886
Predicted Effect probably benign
Transcript: ENSMUST00000230981
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130544439 missense probably damaging 1.00
IGL01734:Ptpra APN 2 130544077 missense probably damaging 1.00
IGL02218:Ptpra APN 2 130552335 splice site probably benign
IGL02385:Ptpra APN 2 130540473 unclassified probably benign
IGL02480:Ptpra APN 2 130504261 missense probably benign 0.09
IGL03181:Ptpra APN 2 130517787 missense probably damaging 0.99
R0374:Ptpra UTSW 2 130537621 missense probably damaging 1.00
R0483:Ptpra UTSW 2 130539685 missense probably damaging 1.00
R0848:Ptpra UTSW 2 130518991 missense probably damaging 1.00
R1550:Ptpra UTSW 2 130541393 missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130544952 missense probably damaging 1.00
R1689:Ptpra UTSW 2 130503492 missense probably benign 0.01
R1760:Ptpra UTSW 2 130549827 missense probably damaging 1.00
R1943:Ptpra UTSW 2 130544104 missense probably damaging 1.00
R2114:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2115:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2117:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2187:Ptpra UTSW 2 130504299 missense probably benign
R2848:Ptpra UTSW 2 130544999 missense probably benign 0.06
R2849:Ptpra UTSW 2 130544999 missense probably benign 0.06
R4644:Ptpra UTSW 2 130544158 missense probably damaging 1.00
R4779:Ptpra UTSW 2 130537617 missense probably damaging 1.00
R4849:Ptpra UTSW 2 130532161 missense probably damaging 1.00
R4899:Ptpra UTSW 2 130544436 missense probably damaging 1.00
R5657:Ptpra UTSW 2 130504284 missense probably benign 0.06
R6018:Ptpra UTSW 2 130503502 missense probably benign
R6234:Ptpra UTSW 2 130537588 missense probably damaging 1.00
R6856:Ptpra UTSW 2 130519381 missense probably damaging 1.00
R7072:Ptpra UTSW 2 130553430 missense probably damaging 1.00
R7146:Ptpra UTSW 2 130537651 critical splice donor site probably null
R7220:Ptpra UTSW 2 130544497 missense probably damaging 1.00
R7346:Ptpra UTSW 2 130553400 missense probably damaging 1.00
R7819:Ptpra UTSW 2 130504206 missense probably benign
R8044:Ptpra UTSW 2 130544961 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGCATGGTAGCAGCTGCAC -3'
(R):5'- CAGAGCTGGAGGATTCCTTC -3'

Sequencing Primer
(F):5'- TGACCGCTGTCACGTGTG -3'
(R):5'- AGGATTCCTTCTGGCTGCTGC -3'
Posted On2018-04-27