Mutagenetix > Incidental Mutation

Incidental Mutation 'R6350:Myh7b'

514144

Institutional Source

Beutler Lab

Gene Symbol

Myh7b

Ensembl Gene

ENSMUSG00000074652

Gene Name

myosin, heavy chain 7B, cardiac muscle, beta

Synonyms

Myh14

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6350 (G1)

Quality Score

161.009

Status

Not validated

Chromosome

Chromosomal Location

155611212-155634307 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 155628760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1043 (C1043S)

Ref Sequence

ENSEMBL: ENSMUSP00000090672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092995]

AlphaFold

A2AQP0

Predicted Effect

probably benign
Transcript: ENSMUST00000092995
AA Change: C1043S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: C1043S

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	32	72	4.7e-14	PFAM
MYSc	78	786	N/A	SMART
IQ	787	809	2.6e0	SMART
Pfam:Myosin_tail_1	850	1931	5.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154656

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,063,563	K554E	possibly damaging	Het
Acsf2	T	C	11: 94,558,330	M609V	probably benign	Het
Acsm3	A	G	7: 119,768,033	T30A	probably benign	Het
Adam32	T	C	8: 24,863,429	K715E	possibly damaging	Het
Cdk5r1	T	C	11: 80,478,242	L245P	probably damaging	Het
Cntn3	A	G	6: 102,170,618	V926A	probably damaging	Het
Csf2rb	G	A	15: 78,345,552	D440N	probably damaging	Het
D3Ertd751e	T	A	3: 41,753,843	H138Q	probably damaging	Het
D630003M21Rik	A	G	2: 158,220,495	L35P	probably damaging	Het
Faap100	A	T	11: 120,374,580	V490E	probably damaging	Het
Il3ra	A	G	14: 14,348,903	D99G	probably benign	Het
Kcnmb1	A	G	11: 33,964,711	K4R	probably damaging	Het
Larp1	T	A	11: 58,049,831	D594E	probably benign	Het
Lnpep	G	T	17: 17,562,809	H577N	probably benign	Het
Mief1	T	C	15: 80,249,603	I287T	probably damaging	Het
Mras	T	C	9: 99,411,507	S27G	probably damaging	Het
N4bp1	T	C	8: 86,861,968	D114G	probably damaging	Het
Nsmce4a	A	T	7: 130,539,099	I219K	probably damaging	Het
Nynrin	A	T	14: 55,868,076	I848F	probably benign	Het
Olfr1318	T	A	2: 112,156,197	I82N	probably damaging	Het
Olfr1370	T	C	13: 21,072,605	E232G	probably benign	Het
Patj	T	A	4: 98,405,618	S36T	probably benign	Het
Pcdhb15	G	A	18: 37,475,361	V549M	probably damaging	Het
Prl2c5	T	C	13: 13,183,046		probably null	Het
Ptbp3	A	T	4: 59,482,624	D386E	probably damaging	Het
Ptpra	T	C	2: 130,540,592	L451P	probably damaging	Het
Repin1	A	G	6: 48,597,628	D497G	probably damaging	Het
Ryr2	A	G	13: 11,761,396	F1085S	probably damaging	Het
Slc6a18	G	A	13: 73,677,925	A2V	possibly damaging	Het
Wee2	C	T	6: 40,455,105	R203C	probably damaging	Het
Zmynd15	T	C	11: 70,464,431	V388A	probably damaging	Het

Other mutations in Myh7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Myh7b	APN	2	155630292	missense	probably damaging	0.99
IGL01604:Myh7b	APN	2	155632407	missense	probably damaging	0.96
IGL02179:Myh7b	APN	2	155614491	missense	probably benign	0.02
IGL02729:Myh7b	APN	2	155625689	missense	probably damaging	1.00
IGL02804:Myh7b	APN	2	155625723	missense	probably damaging	1.00
IGL02851:Myh7b	APN	2	155628827	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155632903	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155625954	missense	possibly damaging	0.95
IGL02992:Myh7b	APN	2	155621410	missense	probably damaging	0.99
IGL03060:Myh7b	APN	2	155632751	missense	probably damaging	1.00
IGL03061:Myh7b	APN	2	155620111	missense	possibly damaging	0.93
IGL03226:Myh7b	APN	2	155620483	nonsense	probably null
IGL03246:Myh7b	APN	2	155617872	missense	probably damaging	1.00
IGL03382:Myh7b	APN	2	155623479	missense	probably damaging	1.00
euclidian	UTSW	2	155633399	missense	probably benign	0.32
imaginary	UTSW	2	155632255	missense	probably benign	0.36
Irrational	UTSW	2	155630672	unclassified	probably benign
Muscoli	UTSW	2	155620118	nonsense	probably null
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0109:Myh7b	UTSW	2	155611674	missense	possibly damaging	0.92
R0309:Myh7b	UTSW	2	155630672	unclassified	probably benign
R0567:Myh7b	UTSW	2	155626398	missense	probably damaging	1.00
R0619:Myh7b	UTSW	2	155611722	missense	probably benign	0.00
R0927:Myh7b	UTSW	2	155620120	missense	probably damaging	1.00
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0974:Myh7b	UTSW	2	155620427	missense	probably benign
R1137:Myh7b	UTSW	2	155622714	missense	probably damaging	1.00
R1261:Myh7b	UTSW	2	155621083	missense	probably benign	0.00
R1268:Myh7b	UTSW	2	155614046	nonsense	probably null
R1537:Myh7b	UTSW	2	155631787	missense	probably damaging	0.96
R1632:Myh7b	UTSW	2	155620525	missense	probably benign	0.04
R1694:Myh7b	UTSW	2	155613193	missense	probably damaging	0.99
R1697:Myh7b	UTSW	2	155620134	missense	probably damaging	1.00
R1730:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R1762:Myh7b	UTSW	2	155630858	missense	probably damaging	0.96
R1783:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R2105:Myh7b	UTSW	2	155629457	missense	probably benign	0.00
R2140:Myh7b	UTSW	2	155620123	missense	probably damaging	1.00
R2971:Myh7b	UTSW	2	155632255	missense	probably benign	0.36
R3838:Myh7b	UTSW	2	155632989	missense	probably damaging	1.00
R4074:Myh7b	UTSW	2	155618758	missense	probably damaging	0.96
R4191:Myh7b	UTSW	2	155633399	missense	probably benign	0.32
R4689:Myh7b	UTSW	2	155630514	missense	possibly damaging	0.75
R4695:Myh7b	UTSW	2	155614177	missense	probably damaging	1.00
R4697:Myh7b	UTSW	2	155629322	missense	probably damaging	1.00
R4771:Myh7b	UTSW	2	155626394	nonsense	probably null
R4794:Myh7b	UTSW	2	155623266	missense	probably benign	0.00
R4842:Myh7b	UTSW	2	155633989	missense	probably benign	0.45
R4871:Myh7b	UTSW	2	155613500	missense	probably benign	0.18
R5022:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5023:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5025:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5050:Myh7b	UTSW	2	155631750	missense	probably benign	0.00
R5055:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5056:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5161:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5284:Myh7b	UTSW	2	155632314	missense	probably benign
R5422:Myh7b	UTSW	2	155631034	missense	probably damaging	0.99
R5505:Myh7b	UTSW	2	155632672	missense	probably benign	0.01
R5946:Myh7b	UTSW	2	155621395	missense	probably damaging	1.00
R6089:Myh7b	UTSW	2	155622489	missense	probably damaging	1.00
R6103:Myh7b	UTSW	2	155618743	missense	probably damaging	1.00
R6233:Myh7b	UTSW	2	155631799	missense	possibly damaging	0.85
R6292:Myh7b	UTSW	2	155632396	missense	probably damaging	1.00
R6484:Myh7b	UTSW	2	155628643	missense	probably benign	0.05
R6760:Myh7b	UTSW	2	155620118	nonsense	probably null
R6896:Myh7b	UTSW	2	155622568	critical splice donor site	probably null
R6945:Myh7b	UTSW	2	155622232	missense	possibly damaging	0.95
R7020:Myh7b	UTSW	2	155631751	missense	possibly damaging	0.56
R7052:Myh7b	UTSW	2	155614133	missense	probably damaging	1.00
R7102:Myh7b	UTSW	2	155622199	missense	probably damaging	1.00
R7248:Myh7b	UTSW	2	155622186	missense	probably damaging	1.00
R7303:Myh7b	UTSW	2	155618740	missense	probably damaging	1.00
R7360:Myh7b	UTSW	2	155632540	missense	probably benign	0.38
R7652:Myh7b	UTSW	2	155632236	missense	probably damaging	0.99
R7678:Myh7b	UTSW	2	155617778	splice site	probably null
R7703:Myh7b	UTSW	2	155620436	missense	probably null	1.00
R7711:Myh7b	UTSW	2	155620403	missense	probably damaging	1.00
R7923:Myh7b	UTSW	2	155625966	missense	probably benign
R7967:Myh7b	UTSW	2	155614199	splice site	probably null
R8045:Myh7b	UTSW	2	155613181	missense	probably benign	0.00
R8176:Myh7b	UTSW	2	155625966	missense	probably benign	0.06
R8272:Myh7b	UTSW	2	155632904	missense	probably damaging	1.00
R8560:Myh7b	UTSW	2	155623204	missense	possibly damaging	0.93
R8706:Myh7b	UTSW	2	155611749	critical splice donor site	probably null
R8824:Myh7b	UTSW	2	155630381	missense	probably benign	0.02
R8832:Myh7b	UTSW	2	155633262	missense	probably benign	0.00
R9079:Myh7b	UTSW	2	155623254	missense	probably damaging	0.97
R9151:Myh7b	UTSW	2	155632519	missense	probably damaging	1.00
R9311:Myh7b	UTSW	2	155621333	missense	probably damaging	1.00
R9332:Myh7b	UTSW	2	155628802	missense	probably damaging	1.00
R9357:Myh7b	UTSW	2	155621348	missense	probably damaging	1.00
R9388:Myh7b	UTSW	2	155631063	missense	probably benign	0.28
R9583:Myh7b	UTSW	2	155617721	missense	probably damaging	1.00
R9657:Myh7b	UTSW	2	155614043	missense	probably damaging	1.00
R9738:Myh7b	UTSW	2	155614043	missense	probably damaging	1.00
X0013:Myh7b	UTSW	2	155631169	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATCGGGCCTTGACACAGG -3'
(R):5'- GCTGTACATAGCTCTGATCCAG -3'

Sequencing Primer
(F):5'- ACTGGATGAAGCCGTGGTC -3'
(R):5'- CTGAGAAGGAGGGCCCATC -3'

Posted On

2018-04-27