Incidental Mutation 'R6350:D630003M21Rik'
ID514145
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158220495 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 35 (L35P)
Ref Sequence ENSEMBL: ENSMUSP00000130623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect probably damaging
Transcript: ENSMUST00000046944
AA Change: L35P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: L35P

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103121
AA Change: L35P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: L35P

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169335
AA Change: L35P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: L35P

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1594:D630003M21Rik UTSW 2 158211630 missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R4947:D630003M21Rik UTSW 2 158186196 missense unknown
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5789:D630003M21Rik UTSW 2 158216814 missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158217353 missense probably damaging 1.00
R7587:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
R7587:D630003M21Rik UTSW 2 158201056 missense probably damaging 1.00
R7713:D630003M21Rik UTSW 2 158216778 nonsense probably null
R7792:D630003M21Rik UTSW 2 158210162 missense possibly damaging 0.94
R7819:D630003M21Rik UTSW 2 158216798 missense probably damaging 0.97
R7832:D630003M21Rik UTSW 2 158217668 missense probably damaging 1.00
R8115:D630003M21Rik UTSW 2 158216590 missense probably benign 0.23
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCCACCATATTTCTTGTGGGG -3'
(R):5'- AAGTTCCTGAGGTAGGCTGG -3'

Sequencing Primer
(F):5'- ACCATATTTCTTGTGGGGGAGACAC -3'
(R):5'- GGTCTGAAGATCACAGGAGC -3'
Posted On2018-04-27