Incidental Mutation 'R6350:D3Ertd751e'
ID514146
Institutional Source Beutler Lab
Gene Symbol D3Ertd751e
Ensembl Gene ENSMUSG00000025766
Gene NameDNA segment, Chr 3, ERATO Doi 751, expressed
Synonyms4930415G15Rik, 2810009O15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location41742611-41803320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41753843 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 138 (H138Q)
Ref Sequence ENSEMBL: ENSMUSP00000142037 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000026867
Predicted Effect probably benign
Transcript: ENSMUST00000026868
Predicted Effect probably damaging
Transcript: ENSMUST00000108065
AA Change: H138Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000119572
Predicted Effect probably benign
Transcript: ENSMUST00000120167
Predicted Effect probably benign
Transcript: ENSMUST00000143841
Predicted Effect probably damaging
Transcript: ENSMUST00000146165
AA Change: H138Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000192193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192799
Predicted Effect unknown
Transcript: ENSMUST00000193075
AA Change: H83Q
Predicted Effect probably benign
Transcript: ENSMUST00000193228
Predicted Effect probably damaging
Transcript: ENSMUST00000194346
AA Change: H138Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000195030
Predicted Effect probably damaging
Transcript: ENSMUST00000195882
AA Change: H138Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in D3Ertd751e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:D3Ertd751e APN 3 41748697 missense probably benign 0.04
IGL02484:D3Ertd751e APN 3 41753720 splice site probably null
IGL02587:D3Ertd751e APN 3 41753852 missense probably benign
IGL03173:D3Ertd751e APN 3 41756062 missense probably damaging 1.00
IGL03304:D3Ertd751e APN 3 41746729 critical splice donor site probably null
Terre UTSW 3 41758409 splice site probably null
R0239:D3Ertd751e UTSW 3 41753878 missense probably damaging 1.00
R0239:D3Ertd751e UTSW 3 41753878 missense probably damaging 1.00
R4275:D3Ertd751e UTSW 3 41756154 utr 3 prime probably benign
R7001:D3Ertd751e UTSW 3 41758409 splice site probably null
R7134:D3Ertd751e UTSW 3 41753777 critical splice donor site probably null
R7179:D3Ertd751e UTSW 3 41748708 missense probably damaging 0.96
R7318:D3Ertd751e UTSW 3 41802551 splice site probably null
R7358:D3Ertd751e UTSW 3 41746565 missense probably damaging 0.99
R7632:D3Ertd751e UTSW 3 41753728 missense probably benign 0.00
R7896:D3Ertd751e UTSW 3 41756073 missense probably benign 0.01
R7952:D3Ertd751e UTSW 3 41748661 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACAGGCATGGACAACATTTAGTTC -3'
(R):5'- ATCATCAAGCACCAAGTGACTG -3'

Sequencing Primer
(F):5'- TACTAGCTGGAAGAAGAAATGTTTG -3'
(R):5'- AGTGACTGCTGCTCTCACAAG -3'
Posted On2018-04-27