Incidental Mutation 'R6350:Ptbp3'
ID514147
Institutional Source Beutler Lab
Gene Symbol Ptbp3
Ensembl Gene ENSMUSG00000028382
Gene Namepolypyrimidine tract binding protein 3
SynonymsRod1, 5830471K22Rik
Accession Numbers

Genbank: NM_144904; MGI: 1923334; Ensembl: ENSMUST00000030076

Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location59471868-59549364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59482624 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 386 (D386E)
Ref Sequence ENSEMBL: ENSMUSP00000133612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030076] [ENSMUST00000102883] [ENSMUST00000148331] [ENSMUST00000172471] [ENSMUST00000172768] [ENSMUST00000173699] [ENSMUST00000174586] [ENSMUST00000174748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030076
AA Change: D355E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030076
Gene: ENSMUSG00000028382
AA Change: D355E

DomainStartEndE-ValueType
RRM 31 100 2.24e-3 SMART
low complexity region 115 130 N/A INTRINSIC
RRM 154 223 2.51e-6 SMART
low complexity region 277 293 N/A INTRINSIC
RRM 330 399 2.13e-9 SMART
RRM 447 517 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102883
AA Change: D383E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099947
Gene: ENSMUSG00000028382
AA Change: D383E

DomainStartEndE-ValueType
RRM 59 128 2.24e-3 SMART
low complexity region 143 158 N/A INTRINSIC
RRM 182 251 2.51e-6 SMART
low complexity region 305 321 N/A INTRINSIC
RRM 358 427 2.13e-9 SMART
RRM 475 545 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148331
AA Change: D352E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122840
Gene: ENSMUSG00000028382
AA Change: D352E

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172471
AA Change: D117E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133886
Gene: ENSMUSG00000028382
AA Change: D117E

DomainStartEndE-ValueType
PDB:1SJR|A 1 34 2e-11 PDB
Blast:RRM_2 1 37 6e-9 BLAST
low complexity region 44 64 N/A INTRINSIC
RRM 92 161 2.13e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172768
AA Change: D352E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134102
Gene: ENSMUSG00000028382
AA Change: D352E

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173268
Predicted Effect probably damaging
Transcript: ENSMUST00000173699
AA Change: D289E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134290
Gene: ENSMUSG00000028382
AA Change: D289E

DomainStartEndE-ValueType
PDB:2CQ1|A 2 44 7e-18 PDB
low complexity region 49 64 N/A INTRINSIC
RRM 88 157 2.51e-6 SMART
low complexity region 211 227 N/A INTRINSIC
RRM 264 333 2.13e-9 SMART
RRM 381 451 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174586
AA Change: D386E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133612
Gene: ENSMUSG00000028382
AA Change: D386E

DomainStartEndE-ValueType
RRM 62 131 2.24e-3 SMART
low complexity region 146 161 N/A INTRINSIC
RRM 185 254 2.51e-6 SMART
low complexity region 308 324 N/A INTRINSIC
RRM 361 430 2.13e-9 SMART
RRM 478 548 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174748
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds RNA and is a regulator of cell differentiation. The encoded protein preferentially binds to poly(G) and poly(U) sequences in vitro. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Ptbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Ptbp3 APN 4 59477228 missense probably benign 0.29
IGL03035:Ptbp3 APN 4 59477218 missense probably benign 0.00
IGL03118:Ptbp3 APN 4 59501470 missense probably benign 0.03
IGL03257:Ptbp3 APN 4 59493370 splice site probably benign
IGL03279:Ptbp3 APN 4 59476937 missense possibly damaging 0.68
R0557:Ptbp3 UTSW 4 59517684 nonsense probably null
R1741:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R1914:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R1915:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R2679:Ptbp3 UTSW 4 59494615 splice site probably benign
R3798:Ptbp3 UTSW 4 59546166 missense probably benign 0.05
R4793:Ptbp3 UTSW 4 59514297 missense possibly damaging 0.71
R4869:Ptbp3 UTSW 4 59524443 missense possibly damaging 0.79
R5573:Ptbp3 UTSW 4 59485626 missense probably damaging 1.00
R5986:Ptbp3 UTSW 4 59493311 missense probably benign 0.37
R6659:Ptbp3 UTSW 4 59517640 missense probably damaging 1.00
R7283:Ptbp3 UTSW 4 59514384 missense probably benign 0.00
R7523:Ptbp3 UTSW 4 59546159 missense probably benign
R7566:Ptbp3 UTSW 4 59514280 missense probably benign 0.03
YA93:Ptbp3 UTSW 4 59524413 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTGTCAGCAATGACAACGTG -3'
(R):5'- GGGGCATATTCTGAATTCAATGTG -3'

Sequencing Primer
(F):5'- CTGTCAGCAATGACAACGTGTTATG -3'
(R):5'- CAATGTGTTTATGAGATATCTGGGAC -3'
Posted On2018-04-27