Mutagenetix > Incidental Mutations

Incidental Mutation 'R6350:Patj'

514148

Institutional Source

Beutler Lab

Gene Symbol

Patj

Ensembl Gene

ENSMUSG00000061859

Gene Name

PATJ, crumbs cell polarity complex component

Synonyms

Inadl, Cipp

Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6350 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98395785-98719603 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98405618 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 36 (S36T)

Ref Sequence

ENSEMBL: ENSMUSP00000102648 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107030] [ENSMUST00000107033] [ENSMUST00000107034]

Predicted Effect

probably benign
Transcript: ENSMUST00000041284
AA Change: S36T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: S36T

Domain	Start	End	E-Value	Type
L27	8	68	6.53e-9	SMART
PDZ	143	221	1.78e-20	SMART
PDZ	256	328	1.15e-23	SMART
PDZ	374	453	3.15e-21	SMART
coiled coil region	486	513	N/A	INTRINSIC
PDZ	570	641	1.28e-12	SMART
PDZ	696	775	9.5e-16	SMART
low complexity region	980	991	N/A	INTRINSIC
low complexity region	1054	1062	N/A	INTRINSIC
PDZ	1083	1166	8.65e-19	SMART
PDZ	1253	1328	6.12e-19	SMART
low complexity region	1356	1366	N/A	INTRINSIC
low complexity region	1410	1428	N/A	INTRINSIC
PDZ	1480	1555	4.36e-24	SMART
PDZ	1577	1650	2.49e-19	SMART
PDZ	1718	1795	2.13e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107030
AA Change: S36T

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000102645
Gene: ENSMUSG00000061859
AA Change: S36T

Domain	Start	End	E-Value	Type
L27	8	68	6.53e-9	SMART
PDZ	143	221	1.78e-20	SMART
PDZ	256	328	1.15e-23	SMART
PDZ	374	453	3.15e-21	SMART
coiled coil region	486	513	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107033
AA Change: S36T

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859
AA Change: S36T

Domain	Start	End	E-Value	Type
L27	8	68	6.53e-9	SMART
PDZ	143	221	1.78e-20	SMART
PDZ	256	328	1.15e-23	SMART
PDZ	374	453	3.15e-21	SMART
coiled coil region	486	513	N/A	INTRINSIC
low complexity region	648	659	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
PDZ	751	834	8.65e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107034
AA Change: S36T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: S36T

Domain	Start	End	E-Value	Type
L27	8	68	6.53e-9	SMART
PDZ	143	221	1.78e-20	SMART
PDZ	256	328	1.15e-23	SMART
PDZ	374	453	3.15e-21	SMART
coiled coil region	486	513	N/A	INTRINSIC
PDZ	566	637	1.28e-12	SMART
PDZ	692	771	9.5e-16	SMART
low complexity region	976	987	N/A	INTRINSIC
low complexity region	1050	1058	N/A	INTRINSIC
PDZ	1079	1162	8.65e-19	SMART
PDZ	1249	1324	6.12e-19	SMART
low complexity region	1352	1362	N/A	INTRINSIC
low complexity region	1382	1400	N/A	INTRINSIC
PDZ	1452	1499	7.78e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141796

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,063,563	K554E	possibly damaging	Het
Acsf2	T	C	11: 94,558,330	M609V	probably benign	Het
Acsm3	A	G	7: 119,768,033	T30A	probably benign	Het
Adam32	T	C	8: 24,863,429	K715E	possibly damaging	Het
Cdk5r1	T	C	11: 80,478,242	L245P	probably damaging	Het
Cntn3	A	G	6: 102,170,618	V926A	probably damaging	Het
Csf2rb	G	A	15: 78,345,552	D440N	probably damaging	Het
D3Ertd751e	T	A	3: 41,753,843	H138Q	probably damaging	Het
D630003M21Rik	A	G	2: 158,220,495	L35P	probably damaging	Het
Faap100	A	T	11: 120,374,580	V490E	probably damaging	Het
Il3ra	A	G	14: 14,348,903	D99G	probably benign	Het
Kcnmb1	A	G	11: 33,964,711	K4R	probably damaging	Het
Larp1	T	A	11: 58,049,831	D594E	probably benign	Het
Lnpep	G	T	17: 17,562,809	H577N	probably benign	Het
Mief1	T	C	15: 80,249,603	I287T	probably damaging	Het
Mras	T	C	9: 99,411,507	S27G	probably damaging	Het
Myh7b	T	A	2: 155,628,760	C1043S	probably benign	Het
N4bp1	T	C	8: 86,861,968	D114G	probably damaging	Het
Nsmce4a	A	T	7: 130,539,099	I219K	probably damaging	Het
Nynrin	A	T	14: 55,868,076	I848F	probably benign	Het
Olfr1318	T	A	2: 112,156,197	I82N	probably damaging	Het
Olfr1370	T	C	13: 21,072,605	E232G	probably benign	Het
Pcdhb15	G	A	18: 37,475,361	V549M	probably damaging	Het
Prl2c5	T	C	13: 13,183,046		probably null	Het
Ptbp3	A	T	4: 59,482,624	D386E	probably damaging	Het
Ptpra	T	C	2: 130,540,592	L451P	probably damaging	Het
Repin1	A	G	6: 48,597,628	D497G	probably damaging	Het
Ryr2	A	G	13: 11,761,396	F1085S	probably damaging	Het
Slc6a18	G	A	13: 73,677,925	A2V	possibly damaging	Het
Wee2	C	T	6: 40,455,105	R203C	probably damaging	Het
Zmynd15	T	C	11: 70,464,431	V388A	probably damaging	Het

Other mutations in Patj

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Patj	APN	4	98465106	missense	probably damaging	1.00
IGL00095:Patj	APN	4	98535562	missense	possibly damaging	0.78
IGL00517:Patj	APN	4	98441071	missense	possibly damaging	0.95
IGL00802:Patj	APN	4	98424406	missense	possibly damaging	0.93
IGL01064:Patj	APN	4	98496973	missense	possibly damaging	0.95
IGL01110:Patj	APN	4	98413024	missense	probably damaging	0.99
IGL01407:Patj	APN	4	98413050	missense	possibly damaging	0.49
IGL01821:Patj	APN	4	98456211	missense	probably damaging	1.00
IGL02399:Patj	APN	4	98591936	missense	probably damaging	1.00
IGL02494:Patj	APN	4	98703987	splice site	probably benign
IGL02803:Patj	APN	4	98426064	missense	probably damaging	0.99
IGL02931:Patj	APN	4	98411173	splice site	probably benign
IGL03017:Patj	APN	4	98465027	splice site	probably benign
IGL03115:Patj	APN	4	98443803	missense	probably damaging	1.00
IGL03209:Patj	APN	4	98465140	missense	probably null	1.00
IGL03377:Patj	APN	4	98465104	missense	probably damaging	1.00
D4186:Patj	UTSW	4	98638762	missense	probably benign	0.17
PIT4531001:Patj	UTSW	4	98441090	missense	probably damaging	0.98
R0136:Patj	UTSW	4	98667648	missense	probably damaging	1.00
R0294:Patj	UTSW	4	98497048	missense	probably damaging	0.99
R0376:Patj	UTSW	4	98568987	missense	probably damaging	1.00
R0463:Patj	UTSW	4	98674308	missense	probably damaging	1.00
R0465:Patj	UTSW	4	98535507	splice site	probably null
R0466:Patj	UTSW	4	98688156	missense	probably damaging	1.00
R0544:Patj	UTSW	4	98569110	missense	probably damaging	1.00
R0624:Patj	UTSW	4	98681235	splice site	probably benign
R0657:Patj	UTSW	4	98667648	missense	probably damaging	1.00
R1281:Patj	UTSW	4	98416695	missense	probably damaging	1.00
R1393:Patj	UTSW	4	98424411	missense	probably benign	0.01
R1480:Patj	UTSW	4	98469582	missense	probably damaging	1.00
R1667:Patj	UTSW	4	98413027	missense	probably damaging	1.00
R1728:Patj	UTSW	4	98431780	missense	possibly damaging	0.50
R1729:Patj	UTSW	4	98431780	missense	possibly damaging	0.50
R1797:Patj	UTSW	4	98687438	missense	probably damaging	1.00
R1818:Patj	UTSW	4	98623648	missense	possibly damaging	0.85
R1835:Patj	UTSW	4	98491590	missense	probably benign	0.00
R1880:Patj	UTSW	4	98497240	missense	probably benign	0.00
R2009:Patj	UTSW	4	98456169	missense	probably damaging	1.00
R2090:Patj	UTSW	4	98437323	unclassified	probably benign
R2120:Patj	UTSW	4	98456225	missense	probably benign	0.01
R2180:Patj	UTSW	4	98523502	critical splice donor site	probably null
R2655:Patj	UTSW	4	98437450	missense	possibly damaging	0.64
R3156:Patj	UTSW	4	98674228	missense	probably damaging	1.00
R3749:Patj	UTSW	4	98469600	missense	probably damaging	1.00
R3767:Patj	UTSW	4	98681219	nonsense	probably null
R3913:Patj	UTSW	4	98569101	missense	probably damaging	0.99
R3917:Patj	UTSW	4	98592008	nonsense	probably null
R3918:Patj	UTSW	4	98456218	missense	probably damaging	1.00
R4299:Patj	UTSW	4	98677321	missense	possibly damaging	0.89
R4355:Patj	UTSW	4	98650454	missense	possibly damaging	0.87
R4471:Patj	UTSW	4	98535579	missense	probably damaging	1.00
R4762:Patj	UTSW	4	98405570	nonsense	probably null
R4877:Patj	UTSW	4	98569058	missense	possibly damaging	0.94
R4945:Patj	UTSW	4	98495064	missense	probably damaging	0.97
R5274:Patj	UTSW	4	98518981	missense	probably damaging	0.99
R5343:Patj	UTSW	4	98676193	missense	probably damaging	1.00
R5554:Patj	UTSW	4	98454396	missense	possibly damaging	0.79
R5688:Patj	UTSW	4	98520810	nonsense	probably null
R5880:Patj	UTSW	4	98411145	missense	probably damaging	0.96
R5972:Patj	UTSW	4	98569053	missense	probably damaging	0.98
R6149:Patj	UTSW	4	98424325	missense	possibly damaging	0.72
R6192:Patj	UTSW	4	98456157	missense	probably damaging	1.00
R6265:Patj	UTSW	4	98469567	missense	probably benign	0.08
R6363:Patj	UTSW	4	98431860	missense	probably benign	0.25
R6434:Patj	UTSW	4	98491629	missense	probably damaging	1.00
R6496:Patj	UTSW	4	98416752	missense	probably damaging	1.00
R6896:Patj	UTSW	4	98426050	missense	possibly damaging	0.87
R7039:Patj	UTSW	4	98569078	missense	probably damaging	0.96
R7040:Patj	UTSW	4	98441080	missense	probably benign	0.02
R7052:Patj	UTSW	4	98677260	missense	probably benign	0.03
R7066:Patj	UTSW	4	98413197	missense	probably benign	0.24
R7236:Patj	UTSW	4	98411057	missense	probably damaging	1.00
R7242:Patj	UTSW	4	98591933	missense	probably benign	0.26
R7260:Patj	UTSW	4	98416733	missense	possibly damaging	0.94
R7412:Patj	UTSW	4	98411139	missense	probably damaging	0.98
R7493:Patj	UTSW	4	98495061	missense	probably benign	0.41
R7570:Patj	UTSW	4	98424500	splice site	probably null
R7571:Patj	UTSW	4	98568980	missense	probably damaging	1.00
R7626:Patj	UTSW	4	98546987	missense	probably benign	0.35
R7658:Patj	UTSW	4	98688179	missense	probably damaging	1.00
R7664:Patj	UTSW	4	98496950	missense	possibly damaging	0.92
R7669:Patj	UTSW	4	98518942	missense	probably damaging	1.00
R7796:Patj	UTSW	4	98546983	start codon destroyed	probably benign	0.05
R7870:Patj	UTSW	4	98424316	missense	probably damaging	1.00
R7883:Patj	UTSW	4	98611135	missense	probably benign	0.00
R7948:Patj	UTSW	4	98424310	missense	probably damaging	0.99
R8050:Patj	UTSW	4	98538964	missense	probably benign	0.00
R8483:Patj	UTSW	4	98424302	missense	probably damaging	1.00
R8546:Patj	UTSW	4	98437397	missense	probably benign	0.00
Z1176:Patj	UTSW	4	98611130	missense	probably benign	0.11
Z1176:Patj	UTSW	4	98676318	nonsense	probably null
Z1177:Patj	UTSW	4	98497174	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATGCCTGAAAACCCTGCTG -3'
(R):5'- ATGCTATCTACAGCTTTCAGGCC -3'

Sequencing Primer
(F):5'- CTGCTGCAGGTATAGACGC -3'
(R):5'- CCACACAGCTTTTACTAATCTAAGAG -3'

Posted On

2018-04-27