Incidental Mutation 'R6350:Wee2'
ID514149
Institutional Source Beutler Lab
Gene Symbol Wee2
Ensembl Gene ENSMUSG00000037159
Gene NameWEE1 homolog 2 (S. pombe)
SynonymsLOC381759, Wee1b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40439088-40466813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40455105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 203 (R203C)
Ref Sequence ENSEMBL: ENSMUSP00000144628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038907] [ENSMUST00000202464]
Predicted Effect probably damaging
Transcript: ENSMUST00000038907
AA Change: R203C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038754
Gene: ENSMUSG00000037159
AA Change: R203C

DomainStartEndE-ValueType
low complexity region 117 128 N/A INTRINSIC
Pfam:Pkinase 208 481 3.6e-51 PFAM
Pfam:Pkinase_Tyr 209 478 9.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202464
AA Change: R203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144628
Gene: ENSMUSG00000037159
AA Change: R203C

DomainStartEndE-ValueType
low complexity region 117 128 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Wee2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wee2 APN 6 40462061 missense probably damaging 1.00
IGL01096:Wee2 APN 6 40463253 missense probably benign 0.00
IGL01978:Wee2 APN 6 40455153 missense probably damaging 1.00
IGL03026:Wee2 APN 6 40461981 missense probably benign 0.00
IGL03091:Wee2 APN 6 40462034 missense probably benign 0.02
IGL03350:Wee2 APN 6 40449731 missense probably damaging 1.00
IGL03352:Wee2 APN 6 40452655 critical splice donor site probably null
R0420:Wee2 UTSW 6 40456995 missense probably benign 0.04
R0506:Wee2 UTSW 6 40463253 missense probably benign 0.04
R1205:Wee2 UTSW 6 40443941 start gained probably benign
R1702:Wee2 UTSW 6 40464201 missense probably benign 0.04
R3982:Wee2 UTSW 6 40455241 missense possibly damaging 0.86
R3983:Wee2 UTSW 6 40455241 missense possibly damaging 0.86
R5946:Wee2 UTSW 6 40463212 missense probably null 1.00
R6020:Wee2 UTSW 6 40449620 splice site probably null
R6127:Wee2 UTSW 6 40449767 missense probably damaging 1.00
R6189:Wee2 UTSW 6 40449683 missense probably damaging 1.00
R6342:Wee2 UTSW 6 40444255 missense probably benign 0.05
R6347:Wee2 UTSW 6 40455105 missense probably damaging 1.00
R6513:Wee2 UTSW 6 40452619 missense probably benign 0.00
R7091:Wee2 UTSW 6 40462002 missense probably benign 0.00
R8258:Wee2 UTSW 6 40444180 missense probably benign 0.00
R8259:Wee2 UTSW 6 40444180 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGACTTGTAAGGCTACAAAGGAC -3'
(R):5'- AGTTACCAAATCCAAGCCTGTTC -3'

Sequencing Primer
(F):5'- ACATAGGTGTGGCCAGCC -3'
(R):5'- GCCTGTTCATCCAATACTTTTCAAAG -3'
Posted On2018-04-27