Incidental Mutation 'R6350:N4bp1'
ID514155
Institutional Source Beutler Lab
Gene Symbol N4bp1
Ensembl Gene ENSMUSG00000031652
Gene NameNEDD4 binding protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location86808160-86885258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86861968 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 114 (D114G)
Ref Sequence ENSEMBL: ENSMUSP00000034074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034074]
Predicted Effect probably damaging
Transcript: ENSMUST00000034074
AA Change: D114G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034074
Gene: ENSMUSG00000031652
AA Change: D114G

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 375 390 N/A INTRINSIC
low complexity region 548 571 N/A INTRINSIC
Pfam:RNase_Zc3h12a 614 767 4.7e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in N4bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:N4bp1 APN 8 86861726 missense probably benign 0.01
IGL00659:N4bp1 APN 8 86861802 missense probably damaging 1.00
IGL01484:N4bp1 APN 8 86844772 missense probably damaging 0.99
IGL01788:N4bp1 APN 8 86860996 missense probably benign 0.06
IGL01989:N4bp1 APN 8 86848487 missense probably damaging 1.00
IGL02619:N4bp1 APN 8 86860901 missense probably benign 0.01
IGL03290:N4bp1 APN 8 86848533 missense probably benign 0.31
Acorn UTSW 8 86861906 nonsense probably null
oak UTSW 8 86861796 nonsense probably null
Squirrel UTSW 8 86851709 missense probably damaging 1.00
Stash UTSW 8 86860424 critical splice donor site probably null
walnut UTSW 8 86846912 missense probably damaging 1.00
winter UTSW 8 86861683 missense probably benign
R0760:N4bp1 UTSW 8 86846912 missense probably damaging 1.00
R1202:N4bp1 UTSW 8 86844887 missense probably benign 0.02
R1653:N4bp1 UTSW 8 86844948 missense probably benign 0.10
R1878:N4bp1 UTSW 8 86861541 missense probably damaging 0.98
R2325:N4bp1 UTSW 8 86848460 missense probably damaging 1.00
R2442:N4bp1 UTSW 8 86862040 missense probably damaging 1.00
R2867:N4bp1 UTSW 8 86861405 missense probably benign 0.02
R2867:N4bp1 UTSW 8 86861405 missense probably benign 0.02
R2926:N4bp1 UTSW 8 86861796 nonsense probably null
R3625:N4bp1 UTSW 8 86851709 missense probably damaging 1.00
R3689:N4bp1 UTSW 8 86860556 missense probably damaging 1.00
R3863:N4bp1 UTSW 8 86860427 missense probably benign 0.13
R4872:N4bp1 UTSW 8 86861048 missense probably benign 0.01
R4902:N4bp1 UTSW 8 86861683 missense probably benign
R4965:N4bp1 UTSW 8 86851686 missense possibly damaging 0.69
R5070:N4bp1 UTSW 8 86860537 missense probably damaging 0.98
R5392:N4bp1 UTSW 8 86860420 splice site probably null
R5719:N4bp1 UTSW 8 86851684 missense probably damaging 1.00
R6280:N4bp1 UTSW 8 86853166 missense possibly damaging 0.68
R6292:N4bp1 UTSW 8 86853239 missense probably damaging 0.99
R6543:N4bp1 UTSW 8 86861906 nonsense probably null
R6965:N4bp1 UTSW 8 86844833 missense probably damaging 1.00
R7120:N4bp1 UTSW 8 86860867 missense probably benign 0.01
R7172:N4bp1 UTSW 8 86860424 critical splice donor site probably null
R7791:N4bp1 UTSW 8 86853203 missense probably damaging 0.99
R8084:N4bp1 UTSW 8 86861008 missense probably benign 0.28
R8220:N4bp1 UTSW 8 86844687 makesense probably null
X0067:N4bp1 UTSW 8 86861920 missense probably damaging 1.00
Z1177:N4bp1 UTSW 8 86853159 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTTCAAGGAAGTAGGCAGAATC -3'
(R):5'- ACAGTCATGTCCTGGGGAAC -3'

Sequencing Primer
(F):5'- ACAGGTCCATTGTATAACTGTCTGC -3'
(R):5'- GGGAACTGGTGAATTGGTCTAAC -3'
Posted On2018-04-27