Incidental Mutation 'R6350:Mras'
ID514156
Institutional Source Beutler Lab
Gene Symbol Mras
Ensembl Gene ENSMUSG00000032470
Gene Namemuscle and microspikes RAS
Synonyms2900078C09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location99385420-99437381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99411507 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 27 (S27G)
Ref Sequence ENSEMBL: ENSMUSP00000121307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035045] [ENSMUST00000119472] [ENSMUST00000122384] [ENSMUST00000123771]
Predicted Effect probably damaging
Transcript: ENSMUST00000035045
AA Change: S27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035045
Gene: ENSMUSG00000032470
AA Change: S27G

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119472
AA Change: S27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112407
Gene: ENSMUSG00000032470
AA Change: S27G

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122384
AA Change: S27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113275
Gene: ENSMUSG00000032470
AA Change: S27G

DomainStartEndE-ValueType
RAS 11 178 4.26e-114 SMART
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123771
AA Change: S27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121307
Gene: ENSMUSG00000032470
AA Change: S27G

DomainStartEndE-ValueType
RAS 11 130 1.06e-68 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit a decreased mean percentage of peripheral blood B cells but no other evidence of morphological or neurological defects; mutant astrocytes display normal responsiveness to different trophic factors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Mras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Mras APN 9 99411495 missense probably damaging 1.00
R3918:Mras UTSW 9 99411420 missense probably damaging 1.00
R3919:Mras UTSW 9 99411420 missense probably damaging 1.00
R3981:Mras UTSW 9 99411416 missense probably damaging 1.00
R4950:Mras UTSW 9 99394484 missense probably damaging 1.00
R5375:Mras UTSW 9 99394616 missense probably damaging 1.00
R5501:Mras UTSW 9 99411546 missense probably damaging 1.00
R5624:Mras UTSW 9 99411485 missense probably damaging 0.99
R6349:Mras UTSW 9 99394616 missense probably damaging 1.00
R7453:Mras UTSW 9 99389740 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGCCCCACTAAAACCTC -3'
(R):5'- GACCATGCGTGACAAAGCTC -3'

Sequencing Primer
(F):5'- TAAAACCTCTCAAATTCCCCTGATC -3'
(R):5'- GGAGTCTGTGTTCCTCTATAAGACAC -3'
Posted On2018-04-27