Incidental Mutation 'R6350:Larp1'
ID514158
Institutional Source Beutler Lab
Gene Symbol Larp1
Ensembl Gene ENSMUSG00000037331
Gene NameLa ribonucleoprotein domain family, member 1
Synonyms1810024J12Rik, 3110040D16Rik, Larp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58009064-58062034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58049831 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 594 (D594E)
Ref Sequence ENSEMBL: ENSMUSP00000136673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071487] [ENSMUST00000178636]
Predicted Effect probably benign
Transcript: ENSMUST00000071487
AA Change: D594E

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071421
Gene: ENSMUSG00000037331
AA Change: D594E

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178636
AA Change: D594E

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136673
Gene: ENSMUSG00000037331
AA Change: D594E

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Larp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Larp1 APN 11 58042822 missense possibly damaging 0.91
IGL02114:Larp1 APN 11 58057055 missense probably damaging 1.00
IGL03084:Larp1 APN 11 58057095 missense probably damaging 1.00
IGL03126:Larp1 APN 11 58050877 missense possibly damaging 0.65
IGL03278:Larp1 APN 11 58044056 splice site probably benign
Bayou UTSW 11 58058596 frame shift probably null
R0009:Larp1 UTSW 11 58055473 missense possibly damaging 0.94
R0020:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R0479:Larp1 UTSW 11 58042820 missense possibly damaging 0.92
R0845:Larp1 UTSW 11 58047750 missense probably benign 0.00
R1691:Larp1 UTSW 11 58048048 missense probably benign 0.08
R1793:Larp1 UTSW 11 58049938 missense possibly damaging 0.60
R3618:Larp1 UTSW 11 58057346 missense probably benign 0.03
R4689:Larp1 UTSW 11 58041613 missense probably damaging 1.00
R4797:Larp1 UTSW 11 58047980 nonsense probably null
R5089:Larp1 UTSW 11 58047867 missense possibly damaging 0.92
R5309:Larp1 UTSW 11 58050808 missense possibly damaging 0.72
R5883:Larp1 UTSW 11 58042299 missense probably damaging 0.97
R5951:Larp1 UTSW 11 58049939 missense probably benign 0.14
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6266:Larp1 UTSW 11 58042263 missense probably damaging 0.99
R6650:Larp1 UTSW 11 58058596 frame shift probably null
R6687:Larp1 UTSW 11 58057330 missense probably damaging 0.99
R6736:Larp1 UTSW 11 58042647 splice site probably null
R6881:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R7368:Larp1 UTSW 11 58048078 missense probably damaging 1.00
R7547:Larp1 UTSW 11 58052579 critical splice acceptor site probably null
R7838:Larp1 UTSW 11 58047714 missense possibly damaging 0.82
R8260:Larp1 UTSW 11 58058689 missense probably benign 0.05
R8446:Larp1 UTSW 11 58051209 critical splice donor site probably null
Z1177:Larp1 UTSW 11 58049787 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCTTTGGGCAGCTAGAAAG -3'
(R):5'- TTGGCCAGTTCAGCACTCATC -3'

Sequencing Primer
(F):5'- AGGTCCTCATGTGTTACTATTCCCAG -3'
(R):5'- ACTCATCTTGGCACGCGAAG -3'
Posted On2018-04-27