Incidental Mutation 'R6350:Zmynd15'
ID514159
Institutional Source Beutler Lab
Gene Symbol Zmynd15
Ensembl Gene ENSMUSG00000040829
Gene Namezinc finger, MYND-type containing 15
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70459433-70466202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70464431 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 388 (V388A)
Ref Sequence ENSEMBL: ENSMUSP00000104203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019064] [ENSMUST00000039093] [ENSMUST00000092958] [ENSMUST00000108563] [ENSMUST00000126105] [ENSMUST00000147289]
Predicted Effect probably benign
Transcript: ENSMUST00000019064
SMART Domains Protein: ENSMUSP00000019064
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:SCY 32 94 1e-17 BLAST
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039093
AA Change: V518A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048816
Gene: ENSMUSG00000040829
AA Change: V518A

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 307 353 6.7e-12 PFAM
low complexity region 438 452 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 702 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092958
AA Change: V478A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090635
Gene: ENSMUSG00000040829
AA Change: V478A

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 306 352 6.5e-11 PFAM
low complexity region 437 451 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 662 696 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108563
AA Change: V388A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104203
Gene: ENSMUSG00000040829
AA Change: V388A

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
Pfam:zf-MYND 177 223 2.5e-11 PFAM
low complexity region 308 322 N/A INTRINSIC
low complexity region 393 405 N/A INTRINSIC
low complexity region 572 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126105
SMART Domains Protein: ENSMUSP00000134599
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136029
Predicted Effect probably benign
Transcript: ENSMUST00000147289
SMART Domains Protein: ENSMUSP00000136813
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154475
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a MYND-containing zinc-binding protein with a nuclear localization sequence. A similar gene in mice has been shown to act as a testis-specific transcriptional repressor by recruiting histone deacetylase enzymes to regulate spatiotemporal expression of many haploid genes. This protein may play an important role in spermatogenesis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele of Cxcl16 and Zmynd15 exhibit abnormal spermiogenesis and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Zmynd15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Zmynd15 APN 11 70465916 missense probably damaging 1.00
IGL01351:Zmynd15 APN 11 70463590 missense probably benign 0.28
R0086:Zmynd15 UTSW 11 70464232 missense probably damaging 1.00
R0196:Zmynd15 UTSW 11 70464226 missense probably damaging 1.00
R0667:Zmynd15 UTSW 11 70465118 missense probably damaging 1.00
R1511:Zmynd15 UTSW 11 70464793 missense probably damaging 0.98
R1660:Zmynd15 UTSW 11 70463502 missense probably damaging 1.00
R1750:Zmynd15 UTSW 11 70462567 missense probably benign 0.00
R4344:Zmynd15 UTSW 11 70461068 nonsense probably null
R4594:Zmynd15 UTSW 11 70464182 missense probably damaging 1.00
R4668:Zmynd15 UTSW 11 70462588 missense probably damaging 1.00
R5029:Zmynd15 UTSW 11 70462561 missense probably damaging 1.00
R5075:Zmynd15 UTSW 11 70462120 missense probably damaging 1.00
R5289:Zmynd15 UTSW 11 70466004 missense unknown
R5468:Zmynd15 UTSW 11 70461820 missense probably damaging 1.00
R6665:Zmynd15 UTSW 11 70464810 missense probably benign 0.01
R7078:Zmynd15 UTSW 11 70460755 missense probably damaging 1.00
R7426:Zmynd15 UTSW 11 70462188 missense probably benign 0.06
R7475:Zmynd15 UTSW 11 70461041 missense probably benign
R7673:Zmynd15 UTSW 11 70466040 missense unknown
R8003:Zmynd15 UTSW 11 70460941 missense probably benign 0.00
R8079:Zmynd15 UTSW 11 70459452 unclassified probably benign
Z1088:Zmynd15 UTSW 11 70461135 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TACCCACTGACGGTGTACTATG -3'
(R):5'- ATGCTGCTGGTCACTCTCAG -3'

Sequencing Primer
(F):5'- ACTGACGGTGTACTATGTCATCAC -3'
(R):5'- TGGTCACTCTCAGGTGGCAG -3'
Posted On2018-04-27