Incidental Mutation 'R6350:Acsf2'
ID514161
Institutional Source Beutler Lab
Gene Symbol Acsf2
Ensembl Gene ENSMUSG00000076435
Gene Nameacyl-CoA synthetase family member 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94557102-94601871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94558330 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 609 (M609V)
Ref Sequence ENSEMBL: ENSMUSP00000099453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103164]
Predicted Effect probably benign
Transcript: ENSMUST00000103164
AA Change: M609V

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099453
Gene: ENSMUSG00000076435
AA Change: M609V

DomainStartEndE-ValueType
Pfam:AMP-binding 78 516 3.9e-100 PFAM
Pfam:AMP-binding_C 524 599 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131808
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Acsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Acsf2 APN 11 94570450 missense probably benign 0.00
IGL02218:Acsf2 APN 11 94601763 missense probably benign 0.00
IGL02602:Acsf2 APN 11 94570465 splice site probably benign
Citrus UTSW 11 94571650 missense probably benign 0.11
limonene UTSW 11 94562888 missense probably damaging 0.99
R0047:Acsf2 UTSW 11 94569342 missense probably benign 0.01
R0194:Acsf2 UTSW 11 94561370 missense probably benign 0.00
R1400:Acsf2 UTSW 11 94570316 missense probably benign 0.07
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1403:Acsf2 UTSW 11 94562874 missense probably benign 0.11
R1512:Acsf2 UTSW 11 94561398 splice site probably benign
R2007:Acsf2 UTSW 11 94571640 missense possibly damaging 0.88
R2271:Acsf2 UTSW 11 94558873 nonsense probably null
R3610:Acsf2 UTSW 11 94561346 missense probably benign 0.00
R4447:Acsf2 UTSW 11 94569359 missense possibly damaging 0.68
R4717:Acsf2 UTSW 11 94559546 missense probably benign 0.02
R4857:Acsf2 UTSW 11 94569338 missense probably benign 0.07
R4974:Acsf2 UTSW 11 94569329 missense possibly damaging 0.77
R5090:Acsf2 UTSW 11 94571269 critical splice donor site probably null
R5185:Acsf2 UTSW 11 94562911 missense probably damaging 1.00
R5732:Acsf2 UTSW 11 94569942 unclassified probably benign
R5797:Acsf2 UTSW 11 94571679 missense probably damaging 0.98
R5872:Acsf2 UTSW 11 94573149 missense probably benign 0.16
R6903:Acsf2 UTSW 11 94559591 missense probably benign 0.03
R6912:Acsf2 UTSW 11 94570380 missense probably benign
R7336:Acsf2 UTSW 11 94571650 missense probably benign 0.11
R7531:Acsf2 UTSW 11 94573231 splice site probably null
R8026:Acsf2 UTSW 11 94562888 missense probably damaging 0.99
R8231:Acsf2 UTSW 11 94561362 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACCTCCTTTGTGTGGGAG -3'
(R):5'- GAAGTCACTTCATCCTGATTTGCC -3'

Sequencing Primer
(F):5'- ACCCTCCTTTGTGTGGGAG -3'
(R):5'- CCCAGGGCTTTCTTAGGTTTAGTAC -3'
Posted On2018-04-27