Incidental Mutation 'R6350:Olfr1370'
ID514165
Institutional Source Beutler Lab
Gene Symbol Olfr1370
Ensembl Gene ENSMUSG00000042869
Gene Nameolfactory receptor 1370
SynonymsGA_x6K02T2QHY8-12181473-12182423, MOR256-14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6350 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21069334-21074947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21072605 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 232 (E232G)
Ref Sequence ENSEMBL: ENSMUSP00000149341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058168] [ENSMUST00000215357] [ENSMUST00000215806]
Predicted Effect probably benign
Transcript: ENSMUST00000058168
AA Change: E232G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054533
Gene: ENSMUSG00000042869
AA Change: E232G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 305 1.8e-8 PFAM
Pfam:7tm_4 31 308 3.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 306 1.9e-6 PFAM
Pfam:7tm_1 41 290 2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213848
Predicted Effect probably benign
Transcript: ENSMUST00000215357
AA Change: E232G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000215806
AA Change: E232G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Il3ra A G 14: 14,348,903 D99G probably benign Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Olfr1370
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr1370 APN 13 21072905 missense probably damaging 1.00
IGL02658:Olfr1370 APN 13 21072812 missense probably damaging 1.00
R0281:Olfr1370 UTSW 13 21072374 missense probably benign
R1838:Olfr1370 UTSW 13 21072425 nonsense probably null
R1858:Olfr1370 UTSW 13 21072471 missense probably damaging 0.98
R2181:Olfr1370 UTSW 13 21073224 missense probably damaging 1.00
R4502:Olfr1370 UTSW 13 21072746 missense probably damaging 1.00
R4594:Olfr1370 UTSW 13 21072522 missense probably benign 0.30
R4757:Olfr1370 UTSW 13 21072545 missense probably damaging 1.00
R5222:Olfr1370 UTSW 13 21072569 missense probably damaging 1.00
R6245:Olfr1370 UTSW 13 21072690 missense possibly damaging 0.69
R6360:Olfr1370 UTSW 13 21072583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCCTTGTGATACAATGAGAC -3'
(R):5'- CAACTTTCTCTGCGAGGTCC -3'

Sequencing Primer
(F):5'- GACAAGAAGTCTCTTCATTGCTC -3'
(R):5'- TCCCGGTGATGATCAAGATGTCC -3'
Posted On2018-04-27