Incidental Mutation 'R6350:Il3ra'
ID514167
Institutional Source Beutler Lab
Gene Symbol Il3ra
Ensembl Gene ENSMUSG00000068758
Gene Nameinterleukin 3 receptor, alpha chain
SynonymsIL-3 receptor alpha chain, CD123, SUT-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6350 (G1)
Quality Score222.009
Status Not validated
Chromosome14
Chromosomal Location14346275-14356011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14348903 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 99 (D99G)
Ref Sequence ENSEMBL: ENSMUSP00000153460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090591] [ENSMUST00000223589] [ENSMUST00000224163] [ENSMUST00000224877] [ENSMUST00000225775]
Predicted Effect probably benign
Transcript: ENSMUST00000090591
AA Change: D99G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000088079
Gene: ENSMUSG00000068758
AA Change: D99G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL6Ra-bind 119 233 6.1e-33 PFAM
transmembrane domain 333 355 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223589
AA Change: D99G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000224163
AA Change: D99G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224415
Predicted Effect probably benign
Transcript: ENSMUST00000224877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225560
Predicted Effect probably benign
Transcript: ENSMUST00000225775
AA Change: D99G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
PHENOTYPE: A number of distantly related inbred mouse strains carrying an identical spontaneous deletion at the branch point in intron 7 exhibit a reduced capacity of bone marrow cells to form colonies in response to interleukin-3 in CFU-GM assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,563 K554E possibly damaging Het
Acsf2 T C 11: 94,558,330 M609V probably benign Het
Acsm3 A G 7: 119,768,033 T30A probably benign Het
Adam32 T C 8: 24,863,429 K715E possibly damaging Het
Cdk5r1 T C 11: 80,478,242 L245P probably damaging Het
Cntn3 A G 6: 102,170,618 V926A probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
D3Ertd751e T A 3: 41,753,843 H138Q probably damaging Het
D630003M21Rik A G 2: 158,220,495 L35P probably damaging Het
Faap100 A T 11: 120,374,580 V490E probably damaging Het
Kcnmb1 A G 11: 33,964,711 K4R probably damaging Het
Larp1 T A 11: 58,049,831 D594E probably benign Het
Lnpep G T 17: 17,562,809 H577N probably benign Het
Mief1 T C 15: 80,249,603 I287T probably damaging Het
Mras T C 9: 99,411,507 S27G probably damaging Het
Myh7b T A 2: 155,628,760 C1043S probably benign Het
N4bp1 T C 8: 86,861,968 D114G probably damaging Het
Nsmce4a A T 7: 130,539,099 I219K probably damaging Het
Nynrin A T 14: 55,868,076 I848F probably benign Het
Olfr1318 T A 2: 112,156,197 I82N probably damaging Het
Olfr1370 T C 13: 21,072,605 E232G probably benign Het
Patj T A 4: 98,405,618 S36T probably benign Het
Pcdhb15 G A 18: 37,475,361 V549M probably damaging Het
Prl2c5 T C 13: 13,183,046 probably null Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpra T C 2: 130,540,592 L451P probably damaging Het
Repin1 A G 6: 48,597,628 D497G probably damaging Het
Ryr2 A G 13: 11,761,396 F1085S probably damaging Het
Slc6a18 G A 13: 73,677,925 A2V possibly damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Zmynd15 T C 11: 70,464,431 V388A probably damaging Het
Other mutations in Il3ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02454:Il3ra APN 14 14351113 missense probably benign 0.36
IGL02547:Il3ra APN 14 14351970 missense probably benign 0.01
IGL02550:Il3ra APN 14 14348055 missense probably benign 0.03
IGL02632:Il3ra APN 14 14350807 critical splice donor site probably null
IGL02737:Il3ra APN 14 14350760 missense probably benign 0.02
R0165:Il3ra UTSW 14 14350967 missense probably benign 0.01
R0597:Il3ra UTSW 14 14351166 critical splice donor site probably null
R1109:Il3ra UTSW 14 14349317 missense probably damaging 1.00
R2211:Il3ra UTSW 14 14355029 missense probably benign 0.03
R2409:Il3ra UTSW 14 14349377 splice site probably null
R4258:Il3ra UTSW 14 14347961 missense probably damaging 1.00
R4896:Il3ra UTSW 14 14355381 missense probably benign 0.07
R4994:Il3ra UTSW 14 14351080 missense probably benign 0.19
R5004:Il3ra UTSW 14 14355381 missense probably benign 0.07
R5935:Il3ra UTSW 14 14350799 missense probably damaging 0.99
R6274:Il3ra UTSW 14 14350180 missense probably benign 0.19
R6403:Il3ra UTSW 14 14347137 missense probably damaging 0.98
R6845:Il3ra UTSW 14 14346517 splice site probably null
R7417:Il3ra UTSW 14 14349345 missense probably benign 0.08
R7432:Il3ra UTSW 14 14350691 missense possibly damaging 0.64
R7450:Il3ra UTSW 14 14351090 missense probably benign 0.25
R7917:Il3ra UTSW 14 14350773 missense possibly damaging 0.66
R8048:Il3ra UTSW 14 14348903 missense probably benign 0.07
Z1088:Il3ra UTSW 14 14351129 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATTAATGCAAATTAGTGCTGGCCC -3'
(R):5'- GGTCACACATGGGATCAGAG -3'

Sequencing Primer
(F):5'- AATTAGTGCTGGCCCTACCAC -3'
(R):5'- GGTCACACCTGGCATCATAG -3'
Posted On2018-04-27