Incidental Mutation 'R6359:Igkv13-84'
ID514187
Institutional Source Beutler Lab
Gene Symbol Igkv13-84
Ensembl Gene ENSMUSG00000076538
Gene Nameimmunoglobulin kappa chain variable 13-84
SynonymsIgk-V33
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6359 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location68939602-68940067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 68939608 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 3 (F3V)
Ref Sequence ENSEMBL: ENSMUSP00000100140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103339]
Predicted Effect probably benign
Transcript: ENSMUST00000103339
AA Change: F3V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100140
Gene: ENSMUSG00000076538
AA Change: F3V

DomainStartEndE-ValueType
low complexity region 27 34 N/A INTRINSIC
IGv 38 110 2.55e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 A T 3: 82,004,496 D133V possibly damaging Het
Atp11b A G 3: 35,778,061 I22V probably benign Het
Ccdc18 C T 5: 108,135,525 T34I probably damaging Het
Ces2a A G 8: 104,736,078 I100V probably benign Het
Ddi2 T A 4: 141,684,588 T338S probably damaging Het
Dync1li1 A G 9: 114,713,570 I267V probably benign Het
Fbxo10 A T 4: 45,041,796 V637E possibly damaging Het
Gak T C 5: 108,571,900 E458G probably damaging Het
Glp1r G T 17: 30,929,972 V287F probably damaging Het
Gm2035 G A 12: 87,919,505 T118M probably benign Het
Gsdmc2 T C 15: 63,825,017 E435G probably damaging Het
Hsd11b1 T A 1: 193,242,352 probably benign Het
Igsf9b C A 9: 27,309,599 A87E probably benign Het
Ints1 G T 5: 139,756,217 L1796I probably benign Het
Ipo8 A G 6: 148,777,250 L950P probably benign Het
Lama5 T C 2: 180,195,982 D931G probably benign Het
Lamb1 A G 12: 31,282,716 E327G probably damaging Het
Lrp1b T C 2: 41,295,596 Y1369C probably damaging Het
Mapk3 A G 7: 126,760,756 T67A probably benign Het
Mrpl4 T A 9: 21,007,734 V225E probably damaging Het
Ncln C T 10: 81,490,284 G278S probably damaging Het
Nlrp3 G A 11: 59,548,566 R323Q probably damaging Het
Nol8 A G 13: 49,664,070 D774G probably benign Het
Olfr266 A T 3: 106,822,415 I48N probably damaging Het
Olfr656 T C 7: 104,618,303 V208A probably damaging Het
Plekha8 G T 6: 54,613,119 C23F probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Spata31d1a A G 13: 59,703,106 S403P probably benign Het
Spata31d1c A T 13: 65,035,592 N316I possibly damaging Het
Tmem30c A T 16: 57,276,150 S203T probably benign Het
Ttn T G 2: 76,738,956 N18871H possibly damaging Het
Other mutations in Igkv13-84
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0699:Igkv13-84 UTSW 6 68939651 critical splice donor site probably benign
R4347:Igkv13-84 UTSW 6 68939776 missense probably benign
R4621:Igkv13-84 UTSW 6 68939799 missense possibly damaging 0.91
R4779:Igkv13-84 UTSW 6 68939910 missense probably damaging 1.00
R5110:Igkv13-84 UTSW 6 68939608 missense probably benign
R5251:Igkv13-84 UTSW 6 68939788 missense probably benign 0.28
R6194:Igkv13-84 UTSW 6 68939932 missense possibly damaging 0.95
R6574:Igkv13-84 UTSW 6 68939993 nonsense probably null
R7131:Igkv13-84 UTSW 6 68939780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGTCTGATTTGGGACAC -3'
(R):5'- AATGGTGACTCTGTCTCCTAGAG -3'

Sequencing Primer
(F):5'- TCTGATTTGGGACACCTGGACAC -3'
(R):5'- GTGACTCTGTCTCCTAGAGATACAG -3'
Posted On2018-04-27