Incidental Mutation 'R6359:Mapk3'
ID514190
Institutional Source Beutler Lab
Gene Symbol Mapk3
Ensembl Gene ENSMUSG00000063065
Gene Namemitogen-activated protein kinase 3
Synonymsp44erk1, p44mapk, Prkm3, p44 MAP kinase, Mtap2k, Erk1, Esrk1, Erk-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6359 (G1)
Quality Score202.009
Status Validated
Chromosome7
Chromosomal Location126759601-126765819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126760756 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 67 (T67A)
Ref Sequence ENSEMBL: ENSMUSP00000051619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050201] [ENSMUST00000057669] [ENSMUST00000091328]
Predicted Effect probably benign
Transcript: ENSMUST00000050201
AA Change: T67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101969
Gene: ENSMUSG00000063065
AA Change: T67A

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057669
AA Change: T67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051619
Gene: ENSMUSG00000063065
AA Change: T67A

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Blast:S_TKc 335 372 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000091328
SMART Domains Protein: ENSMUSP00000088880
Gene: ENSMUSG00000063065

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 213 2.5e-24 PFAM
Pfam:Pkinase 1 216 2.2e-58 PFAM
Pfam:APH 17 108 7.6e-7 PFAM
Blast:S_TKc 220 257 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145965
Predicted Effect unknown
Transcript: ENSMUST00000205657
AA Change: T65A
Predicted Effect unknown
Transcript: ENSMUST00000206272
AA Change: T3A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206875
Meta Mutation Damage Score 0.0997 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are hyperactive with impaired T cell maturation and proliferation. Mice homozygous for a knock-out allele on a CD-1 background exhibit normal Mendelian ratios, growth, and no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 A T 3: 82,004,496 D133V possibly damaging Het
Atp11b A G 3: 35,778,061 I22V probably benign Het
Ccdc18 C T 5: 108,135,525 T34I probably damaging Het
Ces2a A G 8: 104,736,078 I100V probably benign Het
Ddi2 T A 4: 141,684,588 T338S probably damaging Het
Dync1li1 A G 9: 114,713,570 I267V probably benign Het
Fbxo10 A T 4: 45,041,796 V637E possibly damaging Het
Gak T C 5: 108,571,900 E458G probably damaging Het
Glp1r G T 17: 30,929,972 V287F probably damaging Het
Gm2035 G A 12: 87,919,505 T118M probably benign Het
Gsdmc2 T C 15: 63,825,017 E435G probably damaging Het
Hsd11b1 T A 1: 193,242,352 probably benign Het
Igkv13-84 T G 6: 68,939,608 F3V probably benign Het
Igsf9b C A 9: 27,309,599 A87E probably benign Het
Ints1 G T 5: 139,756,217 L1796I probably benign Het
Ipo8 A G 6: 148,777,250 L950P probably benign Het
Lama5 T C 2: 180,195,982 D931G probably benign Het
Lamb1 A G 12: 31,282,716 E327G probably damaging Het
Lrp1b T C 2: 41,295,596 Y1369C probably damaging Het
Mrpl4 T A 9: 21,007,734 V225E probably damaging Het
Ncln C T 10: 81,490,284 G278S probably damaging Het
Nlrp3 G A 11: 59,548,566 R323Q probably damaging Het
Nol8 A G 13: 49,664,070 D774G probably benign Het
Olfr266 A T 3: 106,822,415 I48N probably damaging Het
Olfr656 T C 7: 104,618,303 V208A probably damaging Het
Plekha8 G T 6: 54,613,119 C23F probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Spata31d1a A G 13: 59,703,106 S403P probably benign Het
Spata31d1c A T 13: 65,035,592 N316I possibly damaging Het
Tmem30c A T 16: 57,276,150 S203T probably benign Het
Ttn T G 2: 76,738,956 N18871H possibly damaging Het
Other mutations in Mapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mapk3 APN 7 126764774 nonsense probably null
IGL02412:Mapk3 APN 7 126763038 nonsense probably null
wabasha UTSW 7 126763512 nonsense probably null
R0078:Mapk3 UTSW 7 126759805 missense probably damaging 1.00
R0532:Mapk3 UTSW 7 126763386 intron probably benign
R1549:Mapk3 UTSW 7 126763512 nonsense probably null
R2913:Mapk3 UTSW 7 126760806 nonsense probably null
R5220:Mapk3 UTSW 7 126764236 missense probably benign
R5408:Mapk3 UTSW 7 126763835 missense probably damaging 1.00
R5729:Mapk3 UTSW 7 126764807 missense probably benign 0.01
R5929:Mapk3 UTSW 7 126759858 unclassified probably benign
R6307:Mapk3 UTSW 7 126764282 missense probably benign 0.03
R7356:Mapk3 UTSW 7 126760915 critical splice donor site probably null
R7380:Mapk3 UTSW 7 126764795 missense
R7384:Mapk3 UTSW 7 126764291 missense
X0017:Mapk3 UTSW 7 126764248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGTCACTGAAAGGCTGC -3'
(R):5'- TGGCTAAGGTGAAGGATACACATC -3'

Sequencing Primer
(F):5'- ACTGAAAGGCTGCCTGGC -3'
(R):5'- GTGAAGGATACACATCTCTCATGGC -3'
Posted On2018-04-27