Incidental Mutation 'R6359:Ces2a'
ID514191
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Namecarboxylesterase 2A
SynonymsCes6, 9130231C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6359 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location104734003-104741634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104736078 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000127346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: I100V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: I100V

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: I100V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: I100V

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 A T 3: 82,004,496 D133V possibly damaging Het
Atp11b A G 3: 35,778,061 I22V probably benign Het
Ccdc18 C T 5: 108,135,525 T34I probably damaging Het
Ddi2 T A 4: 141,684,588 T338S probably damaging Het
Dync1li1 A G 9: 114,713,570 I267V probably benign Het
Fbxo10 A T 4: 45,041,796 V637E possibly damaging Het
Gak T C 5: 108,571,900 E458G probably damaging Het
Glp1r G T 17: 30,929,972 V287F probably damaging Het
Gm2035 G A 12: 87,919,505 T118M probably benign Het
Gsdmc2 T C 15: 63,825,017 E435G probably damaging Het
Hsd11b1 T A 1: 193,242,352 probably benign Het
Igkv13-84 T G 6: 68,939,608 F3V probably benign Het
Igsf9b C A 9: 27,309,599 A87E probably benign Het
Ints1 G T 5: 139,756,217 L1796I probably benign Het
Ipo8 A G 6: 148,777,250 L950P probably benign Het
Lama5 T C 2: 180,195,982 D931G probably benign Het
Lamb1 A G 12: 31,282,716 E327G probably damaging Het
Lrp1b T C 2: 41,295,596 Y1369C probably damaging Het
Mapk3 A G 7: 126,760,756 T67A probably benign Het
Mrpl4 T A 9: 21,007,734 V225E probably damaging Het
Ncln C T 10: 81,490,284 G278S probably damaging Het
Nlrp3 G A 11: 59,548,566 R323Q probably damaging Het
Nol8 A G 13: 49,664,070 D774G probably benign Het
Olfr266 A T 3: 106,822,415 I48N probably damaging Het
Olfr656 T C 7: 104,618,303 V208A probably damaging Het
Plekha8 G T 6: 54,613,119 C23F probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Spata31d1a A G 13: 59,703,106 S403P probably benign Het
Spata31d1c A T 13: 65,035,592 N316I possibly damaging Het
Tmem30c A T 16: 57,276,150 S203T probably benign Het
Ttn T G 2: 76,738,956 N18871H possibly damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 104741415 makesense probably null
IGL02135:Ces2a APN 8 104740181 missense probably benign 0.00
IGL02529:Ces2a APN 8 104737219 splice site probably benign
IGL02625:Ces2a APN 8 104740278 critical splice donor site probably null
IGL02869:Ces2a APN 8 104739059 missense probably damaging 1.00
IGL03265:Ces2a APN 8 104737443 missense possibly damaging 0.55
IGL03349:Ces2a APN 8 104734080 missense probably damaging 0.99
R0010:Ces2a UTSW 8 104741396 missense probably benign 0.00
R0318:Ces2a UTSW 8 104740824 missense probably damaging 1.00
R0477:Ces2a UTSW 8 104737537 missense probably damaging 0.99
R0561:Ces2a UTSW 8 104737533 missense probably benign 0.35
R0619:Ces2a UTSW 8 104736110 missense probably benign 0.00
R1665:Ces2a UTSW 8 104737555 splice site probably benign
R1737:Ces2a UTSW 8 104740824 missense probably damaging 0.98
R2266:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2267:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2269:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2288:Ces2a UTSW 8 104737437 missense probably damaging 1.00
R2656:Ces2a UTSW 8 104736134 missense probably benign 0.00
R3176:Ces2a UTSW 8 104739378 splice site probably benign
R3906:Ces2a UTSW 8 104739308 missense probably benign 0.00
R4344:Ces2a UTSW 8 104737134 missense probably damaging 1.00
R4708:Ces2a UTSW 8 104737306 missense probably benign 0.14
R4780:Ces2a UTSW 8 104737208 missense probably damaging 1.00
R5434:Ces2a UTSW 8 104737409 missense probably damaging 0.98
R5763:Ces2a UTSW 8 104736124 missense probably benign 0.00
R5828:Ces2a UTSW 8 104739324 missense probably benign 0.00
R6440:Ces2a UTSW 8 104741322 missense probably benign 0.12
R7066:Ces2a UTSW 8 104740248 missense probably damaging 0.99
R7267:Ces2a UTSW 8 104739040 missense probably benign 0.20
R7395:Ces2a UTSW 8 104739641 missense probably benign 0.35
R7455:Ces2a UTSW 8 104737522 missense probably damaging 1.00
R7457:Ces2a UTSW 8 104737389 missense possibly damaging 0.87
R7567:Ces2a UTSW 8 104741298 missense probably benign 0.01
R7683:Ces2a UTSW 8 104737112 missense probably benign 0.00
X0022:Ces2a UTSW 8 104736142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTTTCACATGGCTGGTG -3'
(R):5'- TCAGGGTCTAAACTACAGTGGAG -3'

Sequencing Primer
(F):5'- CACATGGCTGGTGGTCTTTATTG -3'
(R):5'- GTCTAAACTACAGTGGAGCTCAG -3'
Posted On2018-04-27