Incidental Mutation 'R6359:Ces2a'
ID 514191
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 044509-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6359 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105462710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 100 (I100V)
Ref Sequence ENSEMBL: ENSMUSP00000127346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: I100V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: I100V

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: I100V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: I100V

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 A T 3: 81,911,803 (GRCm39) D133V possibly damaging Het
Atp11b A G 3: 35,832,210 (GRCm39) I22V probably benign Het
Ccdc18 C T 5: 108,283,391 (GRCm39) T34I probably damaging Het
Ddi2 T A 4: 141,411,899 (GRCm39) T338S probably damaging Het
Dync1li1 A G 9: 114,542,638 (GRCm39) I267V probably benign Het
Eif1ad14 G A 12: 87,886,275 (GRCm39) T118M probably benign Het
Fbxo10 A T 4: 45,041,796 (GRCm39) V637E possibly damaging Het
Gak T C 5: 108,719,766 (GRCm39) E458G probably damaging Het
Glp1r G T 17: 31,148,946 (GRCm39) V287F probably damaging Het
Gsdmc2 T C 15: 63,696,866 (GRCm39) E435G probably damaging Het
Hsd11b1 T A 1: 192,924,660 (GRCm39) probably benign Het
Igkv13-84 T G 6: 68,916,592 (GRCm39) F3V probably benign Het
Igsf9b C A 9: 27,220,895 (GRCm39) A87E probably benign Het
Ints1 G T 5: 139,741,972 (GRCm39) L1796I probably benign Het
Ipo8 A G 6: 148,678,748 (GRCm39) L950P probably benign Het
Lama5 T C 2: 179,837,775 (GRCm39) D931G probably benign Het
Lamb1 A G 12: 31,332,715 (GRCm39) E327G probably damaging Het
Lrp1b T C 2: 41,185,608 (GRCm39) Y1369C probably damaging Het
Mapk3 A G 7: 126,359,928 (GRCm39) T67A probably benign Het
Mrpl4 T A 9: 20,919,030 (GRCm39) V225E probably damaging Het
Ncln C T 10: 81,326,118 (GRCm39) G278S probably damaging Het
Nlrp3 G A 11: 59,439,392 (GRCm39) R323Q probably damaging Het
Nol8 A G 13: 49,817,546 (GRCm39) D774G probably benign Het
Or11i1 A T 3: 106,729,731 (GRCm39) I48N probably damaging Het
Or52p1 T C 7: 104,267,510 (GRCm39) V208A probably damaging Het
Plekha8 G T 6: 54,590,104 (GRCm39) C23F probably damaging Het
Prkag1 T C 15: 98,712,433 (GRCm39) Y133C probably damaging Het
Spata31d1a A G 13: 59,850,920 (GRCm39) S403P probably benign Het
Spata31d1c A T 13: 65,183,406 (GRCm39) N316I possibly damaging Het
Tmem30c A T 16: 57,096,513 (GRCm39) S203T probably benign Het
Ttn T G 2: 76,569,300 (GRCm39) N18871H possibly damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCATTTTCACATGGCTGGTG -3'
(R):5'- TCAGGGTCTAAACTACAGTGGAG -3'

Sequencing Primer
(F):5'- CACATGGCTGGTGGTCTTTATTG -3'
(R):5'- GTCTAAACTACAGTGGAGCTCAG -3'
Posted On 2018-04-27