Mutagenetix > Incidental Mutation

Incidental Mutation 'R6359:Igsf9b'

514193

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

AI414108, LOC235086

MMRRC Submission

044509-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.529) question?

Stock #

R6359 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27210500-27268842 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27220895 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 87 (A87E)

Ref Sequence

ENSEMBL: ENSMUSP00000149356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

AlphaFold

E9PZ19

Predicted Effect

probably benign
Transcript: ENSMUST00000115247
AA Change: A87E

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: A87E

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133213
AA Change: A87E

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: A87E

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000214357
AA Change: A87E

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (30/30)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic5	A	T	3: 81,911,803 (GRCm39)	D133V	possibly damaging	Het
Atp11b	A	G	3: 35,832,210 (GRCm39)	I22V	probably benign	Het
Ccdc18	C	T	5: 108,283,391 (GRCm39)	T34I	probably damaging	Het
Ces2a	A	G	8: 105,462,710 (GRCm39)	I100V	probably benign	Het
Ddi2	T	A	4: 141,411,899 (GRCm39)	T338S	probably damaging	Het
Dync1li1	A	G	9: 114,542,638 (GRCm39)	I267V	probably benign	Het
Eif1ad14	G	A	12: 87,886,275 (GRCm39)	T118M	probably benign	Het
Fbxo10	A	T	4: 45,041,796 (GRCm39)	V637E	possibly damaging	Het
Gak	T	C	5: 108,719,766 (GRCm39)	E458G	probably damaging	Het
Glp1r	G	T	17: 31,148,946 (GRCm39)	V287F	probably damaging	Het
Gsdmc2	T	C	15: 63,696,866 (GRCm39)	E435G	probably damaging	Het
Hsd11b1	T	A	1: 192,924,660 (GRCm39)		probably benign	Het
Igkv13-84	T	G	6: 68,916,592 (GRCm39)	F3V	probably benign	Het
Ints1	G	T	5: 139,741,972 (GRCm39)	L1796I	probably benign	Het
Ipo8	A	G	6: 148,678,748 (GRCm39)	L950P	probably benign	Het
Lama5	T	C	2: 179,837,775 (GRCm39)	D931G	probably benign	Het
Lamb1	A	G	12: 31,332,715 (GRCm39)	E327G	probably damaging	Het
Lrp1b	T	C	2: 41,185,608 (GRCm39)	Y1369C	probably damaging	Het
Mapk3	A	G	7: 126,359,928 (GRCm39)	T67A	probably benign	Het
Mrpl4	T	A	9: 20,919,030 (GRCm39)	V225E	probably damaging	Het
Ncln	C	T	10: 81,326,118 (GRCm39)	G278S	probably damaging	Het
Nlrp3	G	A	11: 59,439,392 (GRCm39)	R323Q	probably damaging	Het
Nol8	A	G	13: 49,817,546 (GRCm39)	D774G	probably benign	Het
Or11i1	A	T	3: 106,729,731 (GRCm39)	I48N	probably damaging	Het
Or52p1	T	C	7: 104,267,510 (GRCm39)	V208A	probably damaging	Het
Plekha8	G	T	6: 54,590,104 (GRCm39)	C23F	probably damaging	Het
Prkag1	T	C	15: 98,712,433 (GRCm39)	Y133C	probably damaging	Het
Spata31d1a	A	G	13: 59,850,920 (GRCm39)	S403P	probably benign	Het
Spata31d1c	A	T	13: 65,183,406 (GRCm39)	N316I	possibly damaging	Het
Tmem30c	A	T	16: 57,096,513 (GRCm39)	S203T	probably benign	Het
Ttn	T	G	2: 76,569,300 (GRCm39)	N18871H	possibly damaging	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27,230,951 (GRCm39)	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27,245,600 (GRCm39)	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27,239,902 (GRCm39)	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27,244,426 (GRCm39)	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27,244,378 (GRCm39)	missense	probably damaging	0.98
G1Funyon:Igsf9b	UTSW	9	27,246,035 (GRCm39)	utr 3 prime	probably benign
IGL03014:Igsf9b	UTSW	9	27,233,932 (GRCm39)	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27,245,681 (GRCm39)	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27,245,878 (GRCm39)	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27,234,546 (GRCm39)	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27,244,358 (GRCm39)	splice site	probably null
R0613:Igsf9b	UTSW	9	27,238,216 (GRCm39)	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27,234,657 (GRCm39)	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27,230,901 (GRCm39)	nonsense	probably null
R0879:Igsf9b	UTSW	9	27,245,038 (GRCm39)	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27,230,612 (GRCm39)	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27,243,849 (GRCm39)	splice site	probably null
R1162:Igsf9b	UTSW	9	27,238,185 (GRCm39)	missense	probably benign
R1758:Igsf9b	UTSW	9	27,245,548 (GRCm39)	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27,229,123 (GRCm39)	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27,222,889 (GRCm39)	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27,243,028 (GRCm39)	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27,233,535 (GRCm39)	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27,245,633 (GRCm39)	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27,244,792 (GRCm39)	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27,244,792 (GRCm39)	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27,233,519 (GRCm39)	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27,233,519 (GRCm39)	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27,245,873 (GRCm39)	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27,220,774 (GRCm39)	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27,234,213 (GRCm39)	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27,245,548 (GRCm39)	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27,245,548 (GRCm39)	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27,228,752 (GRCm39)	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27,233,946 (GRCm39)	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27,228,733 (GRCm39)	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27,222,968 (GRCm39)	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27,245,572 (GRCm39)	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27,235,475 (GRCm39)	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27,239,826 (GRCm39)	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27,234,531 (GRCm39)	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27,253,871 (GRCm39)	missense	probably benign	0.19
R6367:Igsf9b	UTSW	9	27,220,821 (GRCm39)	nonsense	probably null
R6556:Igsf9b	UTSW	9	27,240,851 (GRCm39)	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27,234,150 (GRCm39)	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27,245,536 (GRCm39)	missense	probably benign
R7180:Igsf9b	UTSW	9	27,233,964 (GRCm39)	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27,242,992 (GRCm39)	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27,245,418 (GRCm39)	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27,234,608 (GRCm39)	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27,257,186 (GRCm39)	missense	probably benign
R7613:Igsf9b	UTSW	9	27,245,418 (GRCm39)	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27,228,660 (GRCm39)	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27,233,907 (GRCm39)	splice site	probably null
R8301:Igsf9b	UTSW	9	27,246,035 (GRCm39)	utr 3 prime	probably benign
R8546:Igsf9b	UTSW	9	27,244,426 (GRCm39)	missense	possibly damaging	0.54
R8553:Igsf9b	UTSW	9	27,244,739 (GRCm39)	missense	probably damaging	0.96
R9438:Igsf9b	UTSW	9	27,243,839 (GRCm39)	missense	probably benign	0.03
R9585:Igsf9b	UTSW	9	27,233,532 (GRCm39)	missense	probably damaging	1.00
R9720:Igsf9b	UTSW	9	27,220,810 (GRCm39)	missense	probably damaging	0.99
X0013:Igsf9b	UTSW	9	27,243,021 (GRCm39)	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27,220,757 (GRCm39)	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27,245,668 (GRCm39)	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27,228,649 (GRCm39)	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27,245,588 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTGTCACCTTGGCTGTC -3'
(R):5'- CACAGAGATAATAGGCCCAGTC -3'

Sequencing Primer
(F):5'- TGTCCTTGGTAGGTGCCCAC -3'
(R):5'- TAGGCCCAGTCAAGAGAAATATC -3'

Posted On

2018-04-27