Incidental Mutation 'R6359:Dync1li1'
ID514194
Institutional Source Beutler Lab
Gene Symbol Dync1li1
Ensembl Gene ENSMUSG00000032435
Gene Namedynein cytoplasmic 1 light intermediate chain 1
SynonymsDnclic1, 1110053F02Rik, LIC-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R6359 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location114688790-114724302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114713570 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 267 (I267V)
Ref Sequence ENSEMBL: ENSMUSP00000035366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047404]
Predicted Effect probably benign
Transcript: ENSMUST00000047404
AA Change: I267V

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035366
Gene: ENSMUSG00000032435
AA Change: I267V

DomainStartEndE-ValueType
Pfam:DLIC 43 519 2.7e-258 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to light intermediate subunit family, whose members are components of the multiprotein cytoplasmic dynein complex, which is involved in intracellular trafficking and chromosome segregation during mitosis. The protein plays a role in moving the spindle assembly checkpoint (SAC) from kinetochores to spindle poles. The protein may also mediate binding to other cargo molecules to facilitate intracellular vesicle trafficking. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit increased anxiety-related response, increased dendrite length, increased neuron migration, and decreased lysosome trafficking. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 A T 3: 82,004,496 D133V possibly damaging Het
Atp11b A G 3: 35,778,061 I22V probably benign Het
Ccdc18 C T 5: 108,135,525 T34I probably damaging Het
Ces2a A G 8: 104,736,078 I100V probably benign Het
Ddi2 T A 4: 141,684,588 T338S probably damaging Het
Fbxo10 A T 4: 45,041,796 V637E possibly damaging Het
Gak T C 5: 108,571,900 E458G probably damaging Het
Glp1r G T 17: 30,929,972 V287F probably damaging Het
Gm2035 G A 12: 87,919,505 T118M probably benign Het
Gsdmc2 T C 15: 63,825,017 E435G probably damaging Het
Hsd11b1 T A 1: 193,242,352 probably benign Het
Igkv13-84 T G 6: 68,939,608 F3V probably benign Het
Igsf9b C A 9: 27,309,599 A87E probably benign Het
Ints1 G T 5: 139,756,217 L1796I probably benign Het
Ipo8 A G 6: 148,777,250 L950P probably benign Het
Lama5 T C 2: 180,195,982 D931G probably benign Het
Lamb1 A G 12: 31,282,716 E327G probably damaging Het
Lrp1b T C 2: 41,295,596 Y1369C probably damaging Het
Mapk3 A G 7: 126,760,756 T67A probably benign Het
Mrpl4 T A 9: 21,007,734 V225E probably damaging Het
Ncln C T 10: 81,490,284 G278S probably damaging Het
Nlrp3 G A 11: 59,548,566 R323Q probably damaging Het
Nol8 A G 13: 49,664,070 D774G probably benign Het
Olfr266 A T 3: 106,822,415 I48N probably damaging Het
Olfr656 T C 7: 104,618,303 V208A probably damaging Het
Plekha8 G T 6: 54,613,119 C23F probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Spata31d1a A G 13: 59,703,106 S403P probably benign Het
Spata31d1c A T 13: 65,035,592 N316I possibly damaging Het
Tmem30c A T 16: 57,276,150 S203T probably benign Het
Ttn T G 2: 76,738,956 N18871H possibly damaging Het
Other mutations in Dync1li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Dync1li1 APN 9 114720597 missense possibly damaging 0.89
R1510:Dync1li1 UTSW 9 114689210 missense possibly damaging 0.59
R1824:Dync1li1 UTSW 9 114709184 missense probably benign 0.01
R1955:Dync1li1 UTSW 9 114721746 missense probably damaging 0.99
R2000:Dync1li1 UTSW 9 114713563 missense probably benign 0.05
R2520:Dync1li1 UTSW 9 114689006 missense probably null 0.17
R2912:Dync1li1 UTSW 9 114715675 missense probably benign 0.31
R4418:Dync1li1 UTSW 9 114706170 missense probably damaging 1.00
R4422:Dync1li1 UTSW 9 114709309 missense probably damaging 1.00
R4646:Dync1li1 UTSW 9 114709169 missense probably damaging 0.96
R4693:Dync1li1 UTSW 9 114706098 missense probably damaging 0.99
R4817:Dync1li1 UTSW 9 114705094 missense probably benign 0.09
R5027:Dync1li1 UTSW 9 114713544 missense probably damaging 1.00
R5274:Dync1li1 UTSW 9 114715205 missense possibly damaging 0.84
R5363:Dync1li1 UTSW 9 114715229 missense probably damaging 0.99
R5902:Dync1li1 UTSW 9 114717861 critical splice acceptor site probably null
R7235:Dync1li1 UTSW 9 114715163 missense possibly damaging 0.58
R7757:Dync1li1 UTSW 9 114709277 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GTTACGTTCTGCTGTCAACAG -3'
(R):5'- TCTCTTCAGAACTGGGCTTG -3'

Sequencing Primer
(F):5'- CTGTCAACAGCTGAAGTGTTTG -3'
(R):5'- CAGAACTGGGCTTGAATAAATCTG -3'
Posted On2018-04-27