Mutagenetix > Incidental Mutation

Incidental Mutation 'R6359:Nol8'

514199

Institutional Source

Beutler Lab

Gene Symbol

Nol8

Ensembl Gene

ENSMUSG00000021392

Gene Name

nucleolar protein 8

Synonyms

5730412B09Rik, D13Ertd548e, 4921532D18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6359 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49653078-49679016 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49664070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 774 (D774G)

Ref Sequence

ENSEMBL: ENSMUSP00000152878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000223467]

AlphaFold

Q3UHX0

Predicted Effect

probably benign
Transcript: ENSMUST00000021824
AA Change: D792G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: D792G

Domain	Start	End	E-Value	Type
RRM	27	103	3.02e-9	SMART
low complexity region	315	327	N/A	INTRINSIC
low complexity region	454	468	N/A	INTRINSIC
low complexity region	712	724	N/A	INTRINSIC
low complexity region	804	816	N/A	INTRINSIC
low complexity region	836	849	N/A	INTRINSIC
coiled coil region	886	916	N/A	INTRINSIC
coiled coil region	955	981	N/A	INTRINSIC
low complexity region	1080	1093	N/A	INTRINSIC
low complexity region	1152	1164	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221083

Predicted Effect

probably benign
Transcript: ENSMUST00000221142
AA Change: D774G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000222197
AA Change: D792G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223346

Predicted Effect

probably benign
Transcript: ENSMUST00000223467
AA Change: D774G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic5	A	T	3: 82,004,496	D133V	possibly damaging	Het
Atp11b	A	G	3: 35,778,061	I22V	probably benign	Het
Ccdc18	C	T	5: 108,135,525	T34I	probably damaging	Het
Ces2a	A	G	8: 104,736,078	I100V	probably benign	Het
Ddi2	T	A	4: 141,684,588	T338S	probably damaging	Het
Dync1li1	A	G	9: 114,713,570	I267V	probably benign	Het
Fbxo10	A	T	4: 45,041,796	V637E	possibly damaging	Het
Gak	T	C	5: 108,571,900	E458G	probably damaging	Het
Glp1r	G	T	17: 30,929,972	V287F	probably damaging	Het
Gm2035	G	A	12: 87,919,505	T118M	probably benign	Het
Gsdmc2	T	C	15: 63,825,017	E435G	probably damaging	Het
Hsd11b1	T	A	1: 193,242,352		probably benign	Het
Igkv13-84	T	G	6: 68,939,608	F3V	probably benign	Het
Igsf9b	C	A	9: 27,309,599	A87E	probably benign	Het
Ints1	G	T	5: 139,756,217	L1796I	probably benign	Het
Ipo8	A	G	6: 148,777,250	L950P	probably benign	Het
Lama5	T	C	2: 180,195,982	D931G	probably benign	Het
Lamb1	A	G	12: 31,282,716	E327G	probably damaging	Het
Lrp1b	T	C	2: 41,295,596	Y1369C	probably damaging	Het
Mapk3	A	G	7: 126,760,756	T67A	probably benign	Het
Mrpl4	T	A	9: 21,007,734	V225E	probably damaging	Het
Ncln	C	T	10: 81,490,284	G278S	probably damaging	Het
Nlrp3	G	A	11: 59,548,566	R323Q	probably damaging	Het
Olfr266	A	T	3: 106,822,415	I48N	probably damaging	Het
Olfr656	T	C	7: 104,618,303	V208A	probably damaging	Het
Plekha8	G	T	6: 54,613,119	C23F	probably damaging	Het
Prkag1	T	C	15: 98,814,552	Y133C	probably damaging	Het
Spata31d1a	A	G	13: 59,703,106	S403P	probably benign	Het
Spata31d1c	A	T	13: 65,035,592	N316I	possibly damaging	Het
Tmem30c	A	T	16: 57,276,150	S203T	probably benign	Het
Ttn	T	G	2: 76,738,956	N18871H	possibly damaging	Het

Other mutations in Nol8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Nol8	APN	13	49662228	missense	probably benign	0.01
IGL01106:Nol8	APN	13	49654481	missense	possibly damaging	0.46
IGL01413:Nol8	APN	13	49659952	missense	possibly damaging	0.82
IGL01540:Nol8	APN	13	49661670	missense	probably benign	0.06
IGL01670:Nol8	APN	13	49661308	missense	possibly damaging	0.54
IGL01672:Nol8	APN	13	49675407	missense	possibly damaging	0.95
IGL02032:Nol8	APN	13	49672772	missense	probably benign
IGL02212:Nol8	APN	13	49662150	missense	possibly damaging	0.87
IGL02323:Nol8	APN	13	49655245	splice site	probably benign
IGL02645:Nol8	APN	13	49665471	critical splice donor site	probably null
IGL02949:Nol8	APN	13	49662402	missense	probably benign	0.01
IGL02954:Nol8	APN	13	49661172	missense	probably benign	0.01
IGL03182:Nol8	APN	13	49664081	missense	probably damaging	1.00
IGL03406:Nol8	APN	13	49661568	missense	probably damaging	1.00
P0047:Nol8	UTSW	13	49654348	splice site	probably null
R0092:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0099:Nol8	UTSW	13	49672689	missense	probably benign
R0145:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0269:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0370:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0374:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0390:Nol8	UTSW	13	49662152	missense	probably damaging	1.00
R0617:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0635:Nol8	UTSW	13	49676758	missense	probably benign	0.05
R0637:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R1246:Nol8	UTSW	13	49676769	missense	probably damaging	1.00
R1446:Nol8	UTSW	13	49655227	missense	probably damaging	1.00
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1627:Nol8	UTSW	13	49661504	missense	probably benign	0.01
R1703:Nol8	UTSW	13	49667457	missense	possibly damaging	0.65
R1751:Nol8	UTSW	13	49667408	missense	probably benign	0.06
R2187:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R2357:Nol8	UTSW	13	49654504	critical splice donor site	probably null
R3081:Nol8	UTSW	13	49678392	unclassified	probably benign
R3969:Nol8	UTSW	13	49660016	nonsense	probably null
R4199:Nol8	UTSW	13	49661748	missense	possibly damaging	0.65
R4720:Nol8	UTSW	13	49662753	missense	probably damaging	1.00
R4927:Nol8	UTSW	13	49654425	missense	possibly damaging	0.79
R5177:Nol8	UTSW	13	49661112	missense	probably benign	0.32
R5512:Nol8	UTSW	13	49676787	missense	probably benign
R5744:Nol8	UTSW	13	49662326	missense	possibly damaging	0.82
R5988:Nol8	UTSW	13	49672614	missense	possibly damaging	0.58
R6048:Nol8	UTSW	13	49653684	critical splice donor site	probably null
R6306:Nol8	UTSW	13	49676353	missense	probably damaging	1.00
R6378:Nol8	UTSW	13	49667355	missense	probably damaging	1.00
R6655:Nol8	UTSW	13	49654392	missense	probably damaging	1.00
R7035:Nol8	UTSW	13	49661202	missense	probably benign	0.06
R7058:Nol8	UTSW	13	49676386	missense	probably damaging	1.00
R7368:Nol8	UTSW	13	49661219	missense	probably benign	0.00
R7450:Nol8	UTSW	13	49660015	missense	probably benign	0.01
R7673:Nol8	UTSW	13	49664780	missense	probably benign	0.15
R7750:Nol8	UTSW	13	49662266	missense	possibly damaging	0.83
R8246:Nol8	UTSW	13	49655248	splice site	probably benign
R9081:Nol8	UTSW	13	49661405	missense	probably benign	0.00
R9127:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R9223:Nol8	UTSW	13	49661262	missense	possibly damaging	0.63
X0020:Nol8	UTSW	13	49661165	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTGAGGTCAAGTTGATTGTTACTG -3'
(R):5'- AAGTTTAAAGGCAGCCTGGG -3'

Sequencing Primer
(F):5'- AGGTCAAGTTGATTGTTACTGGATAC -3'
(R):5'- GGCCTTACTTTCATCAGC -3'

Posted On

2018-04-27